ID: 1055456293

View in Genome Browser
Species Human (GRCh38)
Location 9:76475070-76475092
Sequence CAGTATGTTCAGAGAAAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055456293 Original CRISPR CAGTATGTTCAGAGAAAGCC GGG (reversed) Intronic
907613375 1:55895885-55895907 CAGTATGTTTAGAGAAATTGAGG - Intergenic
910150960 1:84144508-84144530 CAGTATGTTCAGAGAAATGAAGG - Exonic
914864357 1:151413925-151413947 AAATAATTTCAGAGAAAGCCTGG - Intronic
916943941 1:169705157-169705179 CAAGATGTTCAGAGAAAGAGTGG + Intronic
917277842 1:173349689-173349711 CAGTAAGATAAGAGAAAGTCTGG + Intergenic
1063716285 10:8530203-8530225 CAAAACCTTCAGAGAAAGCCAGG + Intergenic
1067220806 10:44343000-44343022 CAGGATGTGGCGAGAAAGCCAGG - Intergenic
1067560971 10:47304164-47304186 CACTGTGTTCAGAGACTGCCAGG + Intronic
1069721043 10:70549555-70549577 CAGTGTCCTCAGAGACAGCCTGG + Intronic
1070700745 10:78600039-78600061 CAGCATGTTCACAGAATGACAGG + Intergenic
1073703872 10:105960368-105960390 CAACATGTACAGAAAAAGCCAGG - Intergenic
1074404275 10:113167662-113167684 TAGTATGTGCAGATAAAGGCTGG + Exonic
1074470836 10:113725278-113725300 CAGCATTTTCAGAGGCAGCCTGG - Intronic
1074728185 10:116337118-116337140 CAGTATTTTCTGACAAAGCTTGG + Intronic
1075680581 10:124328412-124328434 CAGCATGAACAGTGAAAGCCTGG - Intergenic
1075747470 10:124737712-124737734 GAGTATGTTCACAGGAAGACAGG + Intronic
1076423894 10:130353645-130353667 CAGTAGGTTTACAGAAATCCTGG + Intergenic
1080595641 11:33772551-33772573 AAGTATGTTCAGAGATTGACGGG - Intronic
1081927155 11:46840452-46840474 GAGTATGTTAAGGTAAAGCCAGG - Intronic
1082186540 11:49188763-49188785 CAGTAAGTTCTGAGAAAACTTGG + Intronic
1085231769 11:74978141-74978163 CAGTATGGTCAGAGAAGACCTGG + Exonic
1086679801 11:89656610-89656632 CAGTAAGTTCTGAGAAAACTTGG - Intergenic
1088456178 11:110035179-110035201 CAGTATGTACACAGAAATACTGG - Intergenic
1090357263 11:126148242-126148264 AAGTCTGATCAGAGACAGCCTGG + Intergenic
1090875371 11:130784296-130784318 CAGTATGTGCAGGGAAGACCTGG - Intergenic
1096878408 12:54648071-54648093 CTCTATGGTCAGAGGAAGCCAGG - Intronic
1101489007 12:105194837-105194859 CTGTATGTTCAGATAAGGCGTGG + Intronic
1102583639 12:113908157-113908179 GAGTTTCTTCAGGGAAAGCCTGG + Intronic
1104384602 12:128339377-128339399 CAGGAAGTTCAGAGAAAGGAGGG + Intronic
1106982433 13:35303800-35303822 CAGGATGCTCAGAGAAAGATAGG - Intronic
1107180791 13:37456448-37456470 CAGCACCTTCAGAGAAAGCATGG + Intergenic
1110019550 13:70453330-70453352 AAATATGTTCAGAGAACACCTGG - Intergenic
1110077367 13:71263733-71263755 TAGTATTTTAAGAGAATGCCTGG - Intergenic
1111031315 13:82603138-82603160 CAGTATGTTCAGTGCAAGCCAGG - Intergenic
1113825267 13:113247681-113247703 CGGGATGCTCAAAGAAAGCCAGG + Intronic
1114448431 14:22807702-22807724 CAGAATGTTCAGAGAATTCCAGG - Intronic
1114501395 14:23171649-23171671 CATGATGTCCAGAGAAAGCTAGG + Intronic
1114588433 14:23836405-23836427 AAATATGTTCAGAGCAACCCAGG - Intergenic
1116085556 14:40232872-40232894 CAGCCTGTTCAGAGAAATACAGG - Intergenic
1116856975 14:49961172-49961194 CTGTATTTTCAGAGAAGGCGGGG + Intergenic
1118978932 14:70700657-70700679 CACTATCTTCAAAGAGAGCCAGG - Intergenic
1119310222 14:73639947-73639969 CAGGATCTTTAGAGAAAGCTGGG + Intergenic
1121524083 14:94606444-94606466 CAGTGTGTTCTGGGAGAGCCTGG + Intronic
1122528517 14:102407554-102407576 GTTTATGCTCAGAGAAAGCCGGG + Intronic
1125197970 15:37070403-37070425 GAGTGTGTTCTGAGAAAGACTGG + Intronic
1128428878 15:67572178-67572200 CAGTGTGTTTAAAGAATGCCTGG + Intronic
1129078903 15:73022495-73022517 CAGTATTTACAGGGAAACCCTGG + Intergenic
1130769437 15:86909891-86909913 TGGCATGTTCAGAAAAAGCCAGG + Intronic
1130773076 15:86944428-86944450 CAGCATGTGCAGGGAAAGCATGG + Intronic
1134699346 16:16252196-16252218 CAGCATGTTCAGAGAACTGCAGG - Intronic
1134848037 16:17457502-17457524 AAGGATGTTCAGTGAAAGACTGG - Intronic
1135568324 16:23529309-23529331 GCCTATGTCCAGAGAAAGCCCGG + Intronic
1137851597 16:51751369-51751391 CAGTTAGTTCAGAAAATGCCTGG - Intergenic
1138124223 16:54425678-54425700 CAGTATGTTCAGAAACTCCCTGG - Intergenic
1138379440 16:56590003-56590025 CAGGATGTGGAGAGACAGCCAGG + Intronic
1139443892 16:66984858-66984880 CAGTCTTTTCTCAGAAAGCCTGG - Intergenic
1142952256 17:3493100-3493122 CTGTTTGCTCAGAGATAGCCTGG + Intronic
1143172057 17:4936070-4936092 CAGTGTGTTTAGAGAATGGCAGG - Intergenic
1143599470 17:7934744-7934766 CTGCAGGTTAAGAGAAAGCCAGG - Intronic
1143771744 17:9173436-9173458 CAGCATCTTCAGAGAAAAGCAGG - Intronic
1151787700 17:76283307-76283329 GAGTGTGTTCAGAGAAAGGCAGG + Intronic
1152008570 17:77697103-77697125 CATCCTGTTCAGAGAAAGCCTGG + Intergenic
1154352525 18:13597956-13597978 AAGTATGTTCAAAGAAATCAAGG - Intronic
1155400862 18:25437700-25437722 CACTAGGTTCTGAGAAAGCCAGG - Intergenic
1155437378 18:25827298-25827320 CAGTGTCTTCAGAGAGAGCAGGG - Intergenic
1157403734 18:47406685-47406707 CAGTATTTTCAGATAAAAACTGG - Intergenic
1159019135 18:63128685-63128707 CAGAGTCTTCAGAGACAGCCAGG + Exonic
1159784006 18:72692720-72692742 CAGTCTGTCCCGAGAAAGGCAGG - Intergenic
1160120150 18:76122722-76122744 CTGGATGTTCAGAGAAAGGCAGG - Intergenic
1165193732 19:34085072-34085094 GAGGGTGCTCAGAGAAAGCCTGG + Intergenic
1165390763 19:35537411-35537433 CAGTATGTTCAGGGACAGCCAGG + Intronic
1165483164 19:36077942-36077964 CATTATGCTAAGTGAAAGCCAGG - Intronic
1166751629 19:45166622-45166644 CAGGTTTTTCAGAGAAAGCCTGG + Intronic
925590941 2:5508246-5508268 ATTTATGTTCAGAGAAAACCGGG - Intergenic
925830105 2:7885390-7885412 CACAATATTCAGAGAAGGCCTGG + Intergenic
927444619 2:23148152-23148174 CTGTATGTGCAGAGAGAGTCAGG - Intergenic
932133632 2:69209773-69209795 CAGTAAGGTCAGAGACAGCAGGG + Intronic
932499929 2:72174342-72174364 CACCATGCTGAGAGAAAGCCAGG + Intergenic
933935721 2:87202141-87202163 ACATAAGTTCAGAGAAAGCCTGG + Intergenic
934542652 2:95188834-95188856 CAGGATGGCCAGCGAAAGCCTGG - Intergenic
936357428 2:111763684-111763706 ACATAAGTTCAGAGAAAGCCTGG - Intergenic
936744390 2:115557164-115557186 CAGTATGTACAGAGAGAGAGAGG - Intronic
937243532 2:120477640-120477662 CAGTATGTTCAGAAGGAGGCTGG - Intergenic
937318302 2:120946002-120946024 CAGTGTGTGCAAAGAAAGGCTGG - Intronic
939835127 2:147120602-147120624 AAGTATGTGGAGAGAGAGCCAGG + Intergenic
941787640 2:169515895-169515917 CAGTATCTTGTGAGAAAACCAGG + Intronic
943678440 2:190741687-190741709 CAGTATATTCAGAGAAATCTAGG + Intergenic
945035306 2:205699349-205699371 CATAATGTACAGAGAGAGCCTGG + Intronic
945128391 2:206539056-206539078 CAGTATATGAAGAGGAAGCCTGG + Intronic
947171461 2:227316841-227316863 CAGTATTTTTAGAAAAAGCATGG - Intergenic
948184742 2:236012148-236012170 CAATAGGTTAATAGAAAGCCGGG + Intronic
948202846 2:236142306-236142328 CAGATTGTTCAGAAAAAGCAAGG - Intergenic
1171145691 20:22780157-22780179 CACTATGTTGTGAGGAAGCCTGG - Intergenic
1171454163 20:25257768-25257790 CAGTATTTTCTCAGATAGCCAGG + Intronic
1171755145 20:29100227-29100249 AACTATGTTCAGAAAAAGACAGG - Intergenic
1173377759 20:42504817-42504839 CAGTAAATTCAAAGAAAGGCTGG - Intronic
1175698028 20:61117093-61117115 GAGGATGGTCAGACAAAGCCTGG + Intergenic
1176969110 21:15245608-15245630 CAGTATGTGCAGAGAAAGTATGG - Intergenic
1177805662 21:25872356-25872378 CACCATGCTCTGAGAAAGCCAGG + Intergenic
1177881502 21:26701021-26701043 CAGTATGTTAACAGGAACCCTGG + Intergenic
1179634115 21:42696521-42696543 CAGTGGGTGGAGAGAAAGCCAGG - Intronic
1180745858 22:18088430-18088452 CTGGAAGTTCAGAAAAAGCCTGG + Exonic
1183052403 22:35274317-35274339 CAGGATGTTCAGAGAAACCCAGG + Intronic
1183072997 22:35409267-35409289 CAGGATCTTAACAGAAAGCCTGG - Intronic
1183748799 22:39707444-39707466 CAGGATGCTCAGTGAGAGCCGGG + Intergenic
1184091052 22:42293207-42293229 CAGTTTGCTCAGAGTCAGCCAGG - Intronic
1184690509 22:46115234-46115256 CAGTCTGTTCAGACACAGACAGG - Intergenic
1185215206 22:49595169-49595191 CAGTATGGTCACAGAAACACAGG + Intronic
950134947 3:10574449-10574471 TAGTATGCTCTGAGAACGCCAGG - Intronic
950659118 3:14455725-14455747 CAGCACCTTCAGTGAAAGCCAGG - Intronic
952135635 3:30416265-30416287 CAGTAAGATGATAGAAAGCCTGG + Intergenic
952766427 3:36957961-36957983 CAGTAAGTTCAGGGCAAACCAGG - Intergenic
953718938 3:45338644-45338666 CAGTACTTTCTGTGAAAGCCAGG + Intergenic
954130858 3:48560228-48560250 CAGCATGTGCAGAGACAGGCAGG + Intronic
954381877 3:50223520-50223542 CAGTAAGTTCAAGGAAGGCCAGG - Intergenic
955171332 3:56568115-56568137 GAGAATCCTCAGAGAAAGCCTGG + Intronic
956677383 3:71748772-71748794 CAGTATATTCTGAGAAAGCAAGG + Intronic
957303835 3:78430387-78430409 CACTATGTTAAGTGAAAGCCAGG - Intergenic
958040019 3:88216157-88216179 GATTATGTTCTGAGGAAGCCTGG + Intergenic
958612101 3:96438935-96438957 CAGTGCCTTCAGAGAAAGCACGG - Intergenic
959157243 3:102681899-102681921 GAGTAGCTTCTGAGAAAGCCAGG - Intergenic
959565415 3:107827786-107827808 CAGAATGTTCATAAGAAGCCAGG + Intergenic
961541359 3:127601945-127601967 GTGTATCTTCAGAGAAATCCTGG + Intronic
964409082 3:156379582-156379604 CAGCATGTTAAGAAAAAGCAAGG + Intronic
964877679 3:161387169-161387191 CATTTTGTGCAAAGAAAGCCTGG + Intergenic
965563273 3:170082230-170082252 CAGTATGTTAAGTGAAATGCAGG - Intronic
965567308 3:170133900-170133922 CGTTACTTTCAGAGAAAGCCGGG - Intronic
966234627 3:177686841-177686863 CTCTATTTTCAGAGACAGCCTGG - Intergenic
967974987 3:195029017-195029039 AAGTATGTTGAGATAAAGCCTGG + Intergenic
970327210 4:14938505-14938527 CAGTATATTCAGAGAAATTAAGG - Intergenic
974146679 4:57956490-57956512 AATTAGGTTCAGAGAAAGTCTGG - Intergenic
974220002 4:58956001-58956023 CTGAATGTTCAGAGAAACCAAGG - Intergenic
975131100 4:70833904-70833926 CAGTATGCCCAGAGTGAGCCTGG - Intronic
975880292 4:78898136-78898158 CAGTATGTTCAGAGAATTGCAGG + Intronic
980483405 4:133420393-133420415 AAATATGTTCAGAGAAAAACAGG - Intergenic
980636232 4:135507783-135507805 CAGAATCTTCAGAGAAAGCATGG - Intergenic
982862352 4:160468837-160468859 CAATAAGTTCAGAGTAAGTCCGG + Intergenic
984358111 4:178691387-178691409 CAGGATGCTCAGAGAATGCCAGG + Intergenic
986022050 5:3813317-3813339 CAGAATGGTCAGGGAAACCCAGG + Intergenic
986618188 5:9641641-9641663 CAGTAGATTCAGAGGAAGGCTGG - Intronic
988795452 5:34649321-34649343 CAGTATCTTCACAGTAGGCCGGG + Intergenic
988832683 5:35003091-35003113 CAGTGTGTGCAGGGCAAGCCAGG + Intronic
989853905 5:46254160-46254182 AAGTATGTTCAGATAAAAGCTGG - Intergenic
992588591 5:78269682-78269704 AAGTATGATCTGAGAAAGTCTGG + Intronic
993777968 5:92025717-92025739 CAGTATGTTCAGACACACCCAGG + Intergenic
995446933 5:112254930-112254952 CAGGGTCTTCAGAGAGAGCCAGG - Intronic
995645863 5:114310605-114310627 AAATATGTTCAGAGAAAACTGGG + Intergenic
996856251 5:128010711-128010733 CAGTCTCTTCAAAGAAAGCTGGG + Intergenic
996876653 5:128248181-128248203 CACTTTGATCAGAGAAAGCCAGG - Intergenic
999428871 5:151509287-151509309 CAGTATGTTCAGAATAGGGCTGG + Intronic
1000460148 5:161505704-161505726 CACTAAGTTCAGAGAAAACGTGG + Intronic
1001349759 5:170948941-170948963 CAGGATGTTCAGGAACAGCCTGG + Intronic
1001919339 5:175588279-175588301 CAGGAAGTTCAGAGAAAAACAGG + Intergenic
1002154102 5:177261882-177261904 CAGAATGTTCAGAGCCAGCCAGG - Intronic
1003052689 6:2794039-2794061 CAGTAGGCTCTGAGGAAGCCAGG + Intergenic
1003303082 6:4902424-4902446 CAGTAGGTACTGAGCAAGCCTGG + Intronic
1004128254 6:12895018-12895040 AAGTATTTACAGAGAAACCCTGG - Intronic
1004245814 6:13973932-13973954 CATGATGTTCAGTGAAAGCCAGG - Intronic
1004943263 6:20584348-20584370 CAGTGTGTTCTGAGAAAGCAGGG + Intronic
1005679930 6:28196884-28196906 GAGTAGTATCAGAGAAAGCCAGG - Intergenic
1007049066 6:38807327-38807349 CAGTATGTTCAGAGTAATCCTGG - Intronic
1007411825 6:41668122-41668144 CAGGATGTTCAGAGATAGTGTGG - Intergenic
1010364704 6:75036268-75036290 TAGTATGTTCACAGCAAGCACGG - Intergenic
1011019378 6:82794599-82794621 CATAATGTTAAGTGAAAGCCAGG + Intergenic
1014154450 6:118094595-118094617 CAGTAAGGTCAGAGAAAACCAGG + Intronic
1014936173 6:127387625-127387647 CAGGATGATCAGACAAAGTCTGG - Intergenic
1015041561 6:128726961-128726983 CAGTATCTTCAGAAAATTCCTGG - Intergenic
1017499790 6:155013137-155013159 ATCTATGTGCAGAGAAAGCCTGG - Intronic
1021904553 7:25320446-25320468 AAGTGTGTTCAGAGTAGGCCTGG + Intergenic
1027494811 7:78874509-78874531 CTGTATGTTAAGTGAAAGCCAGG + Intronic
1029334119 7:99886042-99886064 CAGGATGTTCAAAGAATTCCAGG + Intronic
1029489959 7:100865792-100865814 CTGCAGGCTCAGAGAAAGCCGGG - Exonic
1032800610 7:135314627-135314649 GAGTATGTTCAGAGAAGGGCTGG - Intergenic
1034690693 7:153011284-153011306 CTGTATTTTCAGAGGAAGTCAGG + Intergenic
1037183782 8:16037194-16037216 GAGTATGAACAGAGAAAGGCAGG + Intergenic
1037837716 8:22224063-22224085 CAGTCTCTTCAGAGCCAGCCTGG + Intronic
1037932537 8:22890638-22890660 CACTATGTTCAGAGGCCGCCTGG + Intronic
1037983267 8:23270336-23270358 CAGTAGATTCAAAGTAAGCCAGG + Intronic
1038585543 8:28785568-28785590 CTGTATGCTCAGAGAAAGATGGG - Intronic
1041567011 8:59290056-59290078 TAGCATGTTCAGAGAAAGAAGGG - Intergenic
1044293144 8:90496252-90496274 CAGTCTGTTAACAGAAACCCTGG - Intergenic
1044989555 8:97783539-97783561 AGGTGTGCTCAGAGAAAGCCTGG - Intronic
1047078849 8:121436812-121436834 CAGTAATTTCTGGGAAAGCCTGG + Intergenic
1051270464 9:15350263-15350285 CAGTATTTTCAGAGAGATCCTGG - Intergenic
1052769739 9:32676654-32676676 TAGTATGGTCAGAGAATTCCTGG - Intergenic
1053191246 9:36071429-36071451 CATTATGTTAAGAGAATGGCAGG - Intronic
1055043324 9:71898912-71898934 CAGGAGTTTCAGAGCAAGCCTGG + Intronic
1055456293 9:76475070-76475092 CAGTATGTTCAGAGAAAGCCGGG - Intronic
1055497837 9:76873114-76873136 CAGTACCTTCCGAGGAAGCCTGG + Intronic
1055677737 9:78682391-78682413 CAGCATGTTAAGTGAAAGCCAGG - Intergenic
1055750745 9:79502154-79502176 CAGTTTGTTTAGAGAATCCCAGG - Intergenic
1056004162 9:82249470-82249492 CAGAATGTTCAGAGAAACATTGG + Intergenic
1057767655 9:97936404-97936426 TTGTATCTCCAGAGAAAGCCTGG + Intronic
1060685360 9:125606188-125606210 CATTATGTTTAGAGGAAGGCAGG + Intronic
1186227364 X:7414208-7414230 CACAATGTTCAGAGAGAGGCAGG + Intergenic
1186829917 X:13379824-13379846 CAGTATTTACACAGAAAGCTGGG + Intergenic
1187679826 X:21756572-21756594 CATTATTTTCAGAGAAATCAGGG + Intronic
1188188858 X:27149106-27149128 CAGAATCTTCACAGTAAGCCTGG + Intergenic
1188947268 X:36321254-36321276 CATTATGTTAAGTGAAAGACAGG + Intronic
1189411301 X:40774446-40774468 TAGAATGTTCAGAGACAGCAGGG + Intergenic
1189989690 X:46582483-46582505 CTGTAGGGTCAGAGAGAGCCAGG - Intronic
1190715213 X:53097194-53097216 CAGAGTGTTCAGGGAAAGCCAGG - Intergenic
1192197154 X:69036176-69036198 CAGTGTGTACAGGGGAAGCCAGG - Intergenic
1192500827 X:71650726-71650748 CAGTAGGTTAGGAGAGAGCCAGG + Intergenic
1194388993 X:93292981-93293003 CAATATTTTCAGACAAAGGCTGG + Intergenic
1196360042 X:114842613-114842635 CAGAATGCTCAGAAGAAGCCTGG + Intronic
1197069236 X:122274024-122274046 CAACATGATCAGAGAAAGACTGG + Intergenic
1201667479 Y:16474910-16474932 CAGTATGTTAAGGGAAAGAAAGG + Intergenic