ID: 1055458030

View in Genome Browser
Species Human (GRCh38)
Location 9:76491408-76491430
Sequence TGGGTGTCCCCCCAGAGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055458028_1055458030 -8 Left 1055458028 9:76491393-76491415 CCTTGTGGTATTTAATGGGTGTC 0: 1
1: 5
2: 91
3: 96
4: 166
Right 1055458030 9:76491408-76491430 TGGGTGTCCCCCCAGAGGTTAGG No data
1055458025_1055458030 1 Left 1055458025 9:76491384-76491406 CCATGATTTCCTTGTGGTATTTA 0: 42
1: 80
2: 47
3: 61
4: 314
Right 1055458030 9:76491408-76491430 TGGGTGTCCCCCCAGAGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055458030 Original CRISPR TGGGTGTCCCCCCAGAGGTT AGG Intronic
No off target data available for this crispr