ID: 1055467044

View in Genome Browser
Species Human (GRCh38)
Location 9:76576259-76576281
Sequence GTAGTTTTGAGGTTCTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055467044_1055467048 8 Left 1055467044 9:76576259-76576281 CCAACAAAGAACCTCAAAACTAC No data
Right 1055467048 9:76576290-76576312 CACTGATTACACATAAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055467044 Original CRISPR GTAGTTTTGAGGTTCTTTGT TGG (reversed) Intergenic
No off target data available for this crispr