ID: 1055467650

View in Genome Browser
Species Human (GRCh38)
Location 9:76581769-76581791
Sequence CTGGGTACTCAGAGGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055467650_1055467657 0 Left 1055467650 9:76581769-76581791 CCAGCCACCCTCTGAGTACCCAG No data
Right 1055467657 9:76581792-76581814 AAGGTACTCCTCACCTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055467650 Original CRISPR CTGGGTACTCAGAGGGTGGC TGG (reversed) Intergenic
No off target data available for this crispr