ID: 1055469141

View in Genome Browser
Species Human (GRCh38)
Location 9:76594173-76594195
Sequence ACAGTCACTAGAATGACCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055469141_1055469144 -9 Left 1055469141 9:76594173-76594195 CCAGAGGTCATTCTAGTGACTGT No data
Right 1055469144 9:76594187-76594209 AGTGACTGTCTTGGTTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055469141 Original CRISPR ACAGTCACTAGAATGACCTC TGG (reversed) Intergenic
No off target data available for this crispr