ID: 1055482747

View in Genome Browser
Species Human (GRCh38)
Location 9:76725976-76725998
Sequence CCTTCTCCCAGCGCGTGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 135}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055482747_1055482758 29 Left 1055482747 9:76725976-76725998 CCTGAGCACGCGCTGGGAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 135
Right 1055482758 9:76726028-76726050 CCTGCCTCTCCATCCTCTTCTGG No data
1055482747_1055482755 2 Left 1055482747 9:76725976-76725998 CCTGAGCACGCGCTGGGAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 135
Right 1055482755 9:76726001-76726023 AGGGGTTGCCAGGGATATGCAGG No data
1055482747_1055482753 -8 Left 1055482747 9:76725976-76725998 CCTGAGCACGCGCTGGGAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 135
Right 1055482753 9:76725991-76726013 GGAGAAGGGCAGGGGTTGCCAGG No data
1055482747_1055482754 -7 Left 1055482747 9:76725976-76725998 CCTGAGCACGCGCTGGGAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 135
Right 1055482754 9:76725992-76726014 GAGAAGGGCAGGGGTTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055482747 Original CRISPR CCTTCTCCCAGCGCGTGCTC AGG (reversed) Intronic
901647417 1:10724082-10724104 CCTTCTCCCAAAGTGTGCTGTGG - Intronic
902048880 1:13546266-13546288 CCTTCTCCCATCACCTGCTTTGG - Intergenic
903070947 1:20726804-20726826 CCTCCTCCCAGGGCTGGCTCAGG - Intronic
904546089 1:31273928-31273950 CCTTCTTCCAGACCCTGCTCAGG - Intronic
905347103 1:37318677-37318699 CCTCCTCCCAGCGGCAGCTCTGG - Intergenic
906069865 1:43008567-43008589 CTTTCTTCCACCGCGTGCTGTGG + Intergenic
909236874 1:73164161-73164183 CCTCCTCCCAGCACTTCCTCAGG + Intergenic
909940271 1:81602997-81603019 CCTTCTACCATCACGTGCTAAGG - Intronic
911935235 1:103961086-103961108 CCTGCTCCCAGCACCTGCTCTGG - Intergenic
915367241 1:155323244-155323266 CCTTCTACCAGGGAGCGCTCCGG + Intronic
916214635 1:162384586-162384608 CCTTCTCCCTGCTTCTGCTCTGG - Intronic
916792373 1:168136226-168136248 CCTTCTCCCAGCCGGGACTCAGG - Intronic
920985357 1:210883953-210883975 CTTCCTCCCAGCCCATGCTCTGG + Intronic
1069558539 10:69413655-69413677 CCTTCTCCTGGCAGGTGCTCAGG + Intronic
1070717845 10:78735374-78735396 CCTTCTCCCACAACTTGCTCAGG + Intergenic
1075132168 10:119749111-119749133 CCTGCTCCCAGCACCTGCTCTGG - Intronic
1075526600 10:123192135-123192157 CCTCCTCCCTGCACATGCTCAGG - Intergenic
1075760201 10:124849684-124849706 CCCTCTCCCAGCGTCTGCTCAGG - Intergenic
1075806707 10:125194232-125194254 CCCTCTCCCAGCCCAGGCTCTGG - Intergenic
1076512779 10:131024278-131024300 CCTTCTCTCAGCTGGTGCCCTGG - Intergenic
1076789786 10:132770765-132770787 CCTTCCGCCAGGGCGTGATCTGG + Intronic
1078594341 11:12674166-12674188 CCGTCTCCCGGCGCGGGCTCCGG - Intergenic
1083540130 11:63506632-63506654 GCTTCTCCCAGCACCTGCCCTGG + Intronic
1087761658 11:102110041-102110063 CCTTTTCCCCGCCCGTGCTCGGG - Intergenic
1091253561 11:134164352-134164374 CCTGCTGCCAGGACGTGCTCCGG - Intronic
1092099559 12:5871932-5871954 CCTTCCCACAGCACATGCTCAGG + Intronic
1094199351 12:27780567-27780589 CCTTTTCCCCGCGCGGGCCCAGG - Exonic
1094443620 12:30506548-30506570 CCTTCTACCAGCCTGTGCACTGG + Intergenic
1096231740 12:49900577-49900599 CCTTCCCCGAGCCCGTGCTGGGG - Intronic
1102489980 12:113284727-113284749 TCTTCTCCAAGCACGTGCCCTGG + Exonic
1102556312 12:113729058-113729080 CCTTCTCCCATTGCCTCCTCTGG - Intergenic
1102689873 12:114751926-114751948 TCTTCTCCCAAAGCCTGCTCAGG + Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1106682086 13:32018411-32018433 CCTCCTCCCATCTCGTTCTCAGG - Intergenic
1112290923 13:98143442-98143464 CCCTCTCCCGGCTCGGGCTCCGG - Intronic
1113473905 13:110566269-110566291 CTTTCTCCCAGCAGGTGCTGAGG - Intergenic
1115592147 14:34874724-34874746 GCTTCTCCCAGCGCGCGGACCGG - Intronic
1118747546 14:68785168-68785190 CCTTCTACCAGCTTGTGCTTTGG - Intergenic
1121021659 14:90584020-90584042 CCTCCACCCTGCGTGTGCTCTGG + Intronic
1121440430 14:93945433-93945455 CCTGCACCCAGTGTGTGCTCAGG - Intronic
1122337953 14:101006212-101006234 ATTTCTCCCAGCGCGGTCTCTGG - Intergenic
1125537487 15:40450482-40450504 CCTTCTCCAAGCACCTGCCCAGG - Intronic
1126379536 15:48031643-48031665 CCTTCCCCCATCGCTGGCTCAGG + Intergenic
1126538446 15:49794903-49794925 ACTTCTCTCAGCTCTTGCTCTGG - Intergenic
1129276786 15:74450751-74450773 CCTTCTCTCTCCTCGTGCTCAGG - Intronic
1129779857 15:78263584-78263606 CCAGCTCCCAACGGGTGCTCAGG - Intergenic
1130559048 15:84944593-84944615 ACTTCTCCCAGATAGTGCTCCGG + Exonic
1132087846 15:98922649-98922671 CCTGCTCCCAGCACGTTCTATGG - Intronic
1132734634 16:1379391-1379413 CCGCTTCCCAGCGCGGGCTCGGG - Intronic
1133072310 16:3254575-3254597 CCTTCTCTCTGCGTTTGCTCAGG + Exonic
1136145584 16:28314594-28314616 CCTTCTCCCAGAGGGAGCTGTGG + Intronic
1136419178 16:30121916-30121938 CCTACTGCCAGCGCACGCTCCGG - Exonic
1138337916 16:56267461-56267483 CCTTGTCCCACAGAGTGCTCGGG - Intronic
1138998164 16:62477857-62477879 CCTGCTCCCAGTGCCAGCTCTGG + Intergenic
1139015420 16:62684033-62684055 TCTGCTCCCAGCACCTGCTCTGG + Intergenic
1141662189 16:85447304-85447326 CCTTCTTCCAGTGCCTTCTCAGG - Intergenic
1143365854 17:6408078-6408100 CATTCTCCCTGCTGGTGCTCAGG + Intronic
1143500729 17:7337047-7337069 CCCTCCCCCAGCACCTGCTCTGG + Intronic
1147886748 17:43689474-43689496 ACTTCTCCCTGCTAGTGCTCTGG + Intergenic
1148747730 17:49927811-49927833 CCTTGTGCCAGCGCTGGCTCGGG - Intergenic
1151564907 17:74892663-74892685 CATTCTCCCAGCGCAGGCACAGG + Exonic
1151977170 17:77489504-77489526 CCTCCTCCCAGCCCTGGCTCAGG - Intronic
1157326639 18:46673908-46673930 CCTCTTCCCAGAGGGTGCTCTGG + Intronic
1157615790 18:48987061-48987083 CCTTCTCCCACCGCATGTCCAGG - Intergenic
1158421876 18:57302068-57302090 CCAGCTCCCAGAGCGTGCTCTGG - Intergenic
1161361077 19:3850138-3850160 CCTTCTCCCAGAGGGTGCCTGGG - Intronic
1163290542 19:16376698-16376720 CCTTCTCCCTGTCCGTGCTCAGG - Intronic
1165312825 19:35039324-35039346 CCTCCTCCCTGCCCGGGCTCCGG - Intronic
1167930264 19:52857780-52857802 CCTCCTCCCAACCCGTTCTCCGG + Intergenic
924982964 2:239984-240006 CCTTCCCCCAGCCCCTGGTCAGG + Intronic
925404151 2:3595147-3595169 CGTTCGCCTAGCGCGTGCTCAGG + Intronic
926892306 2:17649219-17649241 CTTTCTCACAGCAGGTGCTCAGG - Intronic
927552360 2:24010808-24010830 CCTGCTCCCTGCTCGTGCCCAGG + Intronic
931441950 2:62296382-62296404 CCTTCGCCCACGGTGTGCTCTGG + Intergenic
932454811 2:71842668-71842690 CCTTGTCTCAGGGCCTGCTCTGG + Intergenic
934523113 2:95032329-95032351 CCTACTCCCAGCCCCTTCTCTGG - Intronic
937892504 2:126949289-126949311 CACTCTCCCAGCCCCTGCTCAGG + Intergenic
937911976 2:127080208-127080230 CCTTGTCCCAGCTCCTGTTCTGG - Intronic
942679581 2:178463058-178463080 CGGTCTCCCAGCCCATGCTCTGG + Intergenic
943854322 2:192768931-192768953 CCTTCTCCCAGCACCTCCACAGG + Intergenic
947272441 2:228352235-228352257 CCTTCTCTCAGCAGGTGTTCTGG + Intergenic
948216455 2:236236988-236237010 CGCCCTCCCAGCGTGTGCTCCGG - Intronic
948688378 2:239685986-239686008 CCTCCTCCCAGTGCTTGCTCAGG - Intergenic
948862049 2:240757367-240757389 CCGTCGCACAGCGCGTGCTCCGG + Exonic
949058951 2:241945478-241945500 CCCACTCCCACCGCGGGCTCCGG - Intergenic
1171307385 20:24117951-24117973 CCTCCTCCCAGCGTCTGCTTTGG + Intergenic
1172005974 20:31819375-31819397 CTGTCTCCCAGCGGCTGCTCAGG - Exonic
1172068758 20:32240620-32240642 CCTTCTGCCAGTGCCTGCCCAGG - Intergenic
1174425260 20:50427696-50427718 CCTTCTCCCACCTCGCCCTCAGG + Intergenic
1175174961 20:57105883-57105905 CCTTCTCCCACCCCGTGGTCAGG - Intergenic
1179876622 21:44272140-44272162 CTTTCTCCCAGCGTCTGCCCAGG - Intergenic
1180190791 21:46161612-46161634 GCTTCTCCAGGCGCGCGCTCAGG + Exonic
1183234920 22:36609981-36610003 CAGTCTCCCAGAGCGTGATCAGG + Intronic
1183476515 22:38038847-38038869 CCCTCTCCCAGCGCCTGCACTGG + Intronic
1183577465 22:38700985-38701007 CCCCCGCCCGGCGCGTGCTCCGG + Intronic
1183666610 22:39249851-39249873 CCCTCTCCTAGCGCTGGCTCTGG - Intergenic
1184256026 22:43287491-43287513 CCTTGGCCCAGGGTGTGCTCTGG + Intronic
950316424 3:12005043-12005065 CCTCCTCCCAGCGGGACCTCGGG - Intronic
952759754 3:36903606-36903628 CCTGCTCCCAGGGCCTGCACAGG - Intronic
954238673 3:49276687-49276709 CCTTCTCGCTGCCCGTGCACAGG - Exonic
954370408 3:50167078-50167100 TCTTCTCCCACCCCCTGCTCAGG + Intronic
954716006 3:52527311-52527333 CCTTTTCCAAGCGGGTGATCCGG + Exonic
955287061 3:57652239-57652261 CCTTCTCTCAGTGCTTGCTCTGG + Intronic
959068090 3:101677826-101677848 GCGTCTCCCAGTGCGTGCTGAGG + Intergenic
959389805 3:105759681-105759703 CCTGCTCACAGTGCCTGCTCTGG - Intronic
961184848 3:124905829-124905851 CCTTCTCCCAGCCAGTCTTCGGG + Exonic
961751883 3:129101368-129101390 CCTTGTCCCAGCCTCTGCTCTGG + Intronic
962830888 3:139138986-139139008 CCTTCTTCAAGCCCGTGCTCTGG + Intronic
965009758 3:163073109-163073131 CCTGCTCCCAGTGCCTGTTCTGG + Intergenic
966924446 3:184635276-184635298 CCTTCACTCAGCGCCTGCTAAGG - Intronic
969357824 4:6641021-6641043 CCATCTCCCACAGCTTGCTCCGG - Exonic
969523441 4:7692141-7692163 CCTGCTCCCAGCAGATGCTCAGG - Intronic
969657659 4:8507454-8507476 TCCTCCCCCAGCGCCTGCTCTGG + Intergenic
970325634 4:14920551-14920573 CCTTCTACCAGCTCTTGTTCTGG - Intergenic
973265239 4:48203963-48203985 CCTTCCCCCAGTGCCTGCACAGG - Intronic
979799366 4:124889150-124889172 TCCTCTCCCATAGCGTGCTCAGG - Intergenic
985689768 5:1300677-1300699 GCTTCTCCGAGCCCGTGCTGAGG - Intergenic
987816065 5:22902053-22902075 CCGGCTCCCAGTGCCTGCTCAGG - Intergenic
992232108 5:74673549-74673571 CCTCCTCCCAGTGTGTCCTCCGG + Intronic
994825939 5:104712895-104712917 CTTTCTCCCAGAGGGTGCTTTGG + Intergenic
1002103637 5:176869393-176869415 CCTTCTCCCAGGGGGCACTCGGG - Intronic
1002435050 5:179226097-179226119 CCTCCTCGCAGGGCGTGCTATGG - Intronic
1002444260 5:179279576-179279598 CCTCCTCTCAGAGCCTGCTCGGG + Intronic
1002838977 6:889573-889595 ACTCCTACCAGAGCGTGCTCAGG + Intergenic
1002921304 6:1575272-1575294 CCTTCCCCCAGTGCCTGCCCTGG + Intergenic
1005529630 6:26689807-26689829 CCTTCCCCGAGGGCGAGCTCCGG - Intergenic
1005541166 6:26811840-26811862 CCTTCCCCGAGGGCGAGCTCCGG + Intergenic
1017814731 6:158008574-158008596 CCTTCTCCCAGCCCACGCCCAGG - Intronic
1019415723 7:925768-925790 CCTGCACCCAGCTCGTGCTCGGG + Intronic
1021677584 7:23097094-23097116 CCTGCTCCCAGCACCTGCTCTGG + Intergenic
1022042031 7:26590596-26590618 CCCTCTCACAGCACCTGCTCTGG - Intergenic
1025206141 7:56994338-56994360 CCCTCTCCCAGCGAGTCATCTGG + Intergenic
1025665800 7:63582601-63582623 CCCTCTCCCAGCGAGTCATCTGG - Intergenic
1026731299 7:72913945-72913967 ACTTCTTCCATCGCGTGGTCGGG + Intronic
1027112779 7:75454123-75454145 ACTTCTTCCATCGCGTGGTCGGG - Intronic
1027285022 7:76638734-76638756 ACTTCTTCCATCGCGTGGTCGGG - Intergenic
1031265226 7:119572583-119572605 CCTGCTCCTAGTGCCTGCTCTGG + Intergenic
1033555081 7:142482245-142482267 CCTTCTCCCACCTAGTGCTGTGG - Intergenic
1036781689 8:11652026-11652048 CCTTCTGCTGGCTCGTGCTCAGG - Intergenic
1037683102 8:21115146-21115168 CCTTCTCCCACCCCATTCTCCGG + Intergenic
1039706760 8:40015482-40015504 CCATCTCCCAGGGCCTCCTCAGG + Exonic
1040531463 8:48269787-48269809 CCTTCCCCCAGCGCCTGCCCTGG - Intergenic
1045614065 8:103885678-103885700 CCTTCTCTCATGCCGTGCTCGGG - Exonic
1045784596 8:105905386-105905408 AATTCTCCAAGAGCGTGCTCTGG - Intergenic
1049420071 8:142512534-142512556 CCTTCTCCCAGCCCGGTGTCAGG + Intronic
1049717585 8:144100205-144100227 CCTTCTCCCAGCCTTGGCTCTGG + Intronic
1052597049 9:30574679-30574701 CCTGCTCCCAGGGCTTGCTTTGG + Intergenic
1055482747 9:76725976-76725998 CCTTCTCCCAGCGCGTGCTCAGG - Intronic
1057883269 9:98808783-98808805 CCTGCTGCCAGCGTGTGCCCTGG - Intronic
1060014694 9:120076943-120076965 TTTCCTCCCAGCGAGTGCTCAGG + Intergenic
1061123136 9:128656540-128656562 CCGTCTCCCAGCGGATGCCCTGG + Exonic
1195880374 X:109586671-109586693 CCCACTCCCAGTGCTTGCTCTGG - Intergenic
1197526812 X:127574906-127574928 CCCTCTCCCAGTGCATGCTCTGG + Intergenic
1198778086 X:140202302-140202324 CCTTCCCCCTGAGCCTGCTCAGG + Intergenic