ID: 1055483559

View in Genome Browser
Species Human (GRCh38)
Location 9:76734179-76734201
Sequence CCCTCCTTTCCACAGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 279}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055483559_1055483566 -2 Left 1055483559 9:76734179-76734201 CCCTCCTTCTGTGGAAAGGAGGG 0: 1
1: 0
2: 3
3: 20
4: 279
Right 1055483566 9:76734200-76734222 GGGCTGGGTAGATGTTTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055483559 Original CRISPR CCCTCCTTTCCACAGAAGGA GGG (reversed) Intronic
900802394 1:4745478-4745500 AGCTCCGCTCCACAGAAGGAGGG + Intronic
902587827 1:17451862-17451884 CCCTCCTTCCCTCTGAAGCAAGG - Intergenic
902684821 1:18069253-18069275 CCCTGCTTTCCAGAGAAGCCCGG + Intergenic
903873606 1:26456001-26456023 CTATCCTGTCCACAGAAAGAGGG - Intronic
905015683 1:34777019-34777041 CCCACCTCTCCACTCAAGGAAGG + Intronic
905632054 1:39524452-39524474 CCAGCCTCTCCACACAAGGAGGG + Intronic
905665700 1:39761743-39761765 CTGGCCTCTCCACAGAAGGAGGG - Intronic
905738613 1:40349970-40349992 CCCACCTTTCCACAGAGTCAAGG + Intronic
906142945 1:43544519-43544541 CCCTCCTCTCCCCAGCAGGGAGG - Intronic
906245004 1:44267333-44267355 CCCTCCTGACCACAGTAGAAAGG + Intronic
906932501 1:50183502-50183524 CTCTCCTTCCCAGAGAAGGAAGG - Intronic
907272455 1:53298848-53298870 CCCTCCTTCCCTCAGAGGGCTGG - Intronic
907666111 1:56435053-56435075 CCATCCCTTTCTCAGAAGGAGGG + Intergenic
908451839 1:64263675-64263697 CCCTCTTTTGCAGAGAAGGATGG + Intronic
908731669 1:67232442-67232464 ACCTCACTTCCACAGCAGGATGG - Intronic
909162497 1:72171140-72171162 CTCCCCTTTCCAGAGCAGGAAGG + Intronic
913189902 1:116404637-116404659 CTGTCATTTCCACAGATGGATGG - Exonic
913240445 1:116825551-116825573 CACTCCTTTGGACAGATGGACGG + Intergenic
916502170 1:165396526-165396548 CCCACCTTGCCACAGAGGGTGGG - Intergenic
916750754 1:167721353-167721375 CCCTCCTGGCTTCAGAAGGATGG - Intronic
918160771 1:181897259-181897281 CCCAACTTTTCACAGAAGGTAGG - Intergenic
918866574 1:189907677-189907699 CCATCCTCCCCACAGAAGTATGG - Intergenic
919057141 1:192585257-192585279 ACCCACTTTCCACAGGAGGAGGG - Intergenic
919853081 1:201686840-201686862 CCCCACTGTCCACAGCAGGAAGG + Intronic
920665808 1:207962405-207962427 CCCTCCGGACCACAGAAGTAGGG + Intergenic
921713441 1:218395486-218395508 GACTCCTTTGCACAGAAGGCAGG + Intronic
922494116 1:226042542-226042564 CCCTCTTATCCACAGAATGATGG + Intergenic
922568247 1:226616124-226616146 CCGTCCTTCCCCCAAAAGGAAGG + Intergenic
923369187 1:233293781-233293803 CCCTGCTTTACAAACAAGGAAGG + Intronic
923929497 1:238677812-238677834 CCCTCCTTTCTCCAGATGCAGGG - Intergenic
924298220 1:242610730-242610752 CCCCCTTTTCCACTGAAGGTGGG + Intergenic
1064163396 10:12965186-12965208 CCCTGCTTTCCCCAAAAAGAGGG + Intronic
1066420218 10:35258461-35258483 CCTTCATTTCCAGAGGAGGAGGG + Intronic
1069589661 10:69634047-69634069 GCCTCCTCTCCAGAGAAGCAGGG - Intergenic
1070144177 10:73761690-73761712 CTCTCCTTCTCACTGAAGGAGGG - Intronic
1071288881 10:84173904-84173926 CCATCTTCTCCACAGAAGGTAGG + Exonic
1076094548 10:127720611-127720633 CTCTCCTCTCCTCAGATGGAAGG - Intergenic
1076394965 10:130131649-130131671 TGCTCCTTTACCCAGAAGGAAGG + Intergenic
1076646643 10:131958685-131958707 CCTTCATCTCCACAGGAGGACGG - Intronic
1076646769 10:131959203-131959225 CCTTCATCTCCACAGGAGGACGG - Intronic
1076770996 10:132664775-132664797 CCTTCCTTGGGACAGAAGGATGG - Intronic
1076886908 10:133267224-133267246 CCCTGCTGTACACAGAAGGCTGG - Intronic
1077293980 11:1815460-1815482 CCCTCCCTTCCCCAGGAGAAGGG + Intergenic
1078600331 11:12724787-12724809 CCCTCCTTTCCTTGGAAGGCTGG + Intronic
1079124451 11:17708852-17708874 CCCTCCTGCCCAGAGAAGGGAGG + Intergenic
1081801223 11:45860701-45860723 CCCTCCTTTCCACTCAGGCATGG + Intronic
1083170538 11:60921822-60921844 CCCTGCTCCCCACAGCAGGAAGG - Exonic
1083171129 11:60924615-60924637 ACATCCTTCCCACAGAAGGCGGG - Exonic
1083177552 11:60960792-60960814 CCGTCCTACCCCCAGAAGGAAGG - Intergenic
1083361062 11:62108480-62108502 CTTTCCCTGCCACAGAAGGACGG - Intergenic
1083772451 11:64875853-64875875 GCCTCCTGTCCCCAGCAGGAAGG - Intronic
1084599337 11:70135646-70135668 CCCTCCTCTGCAGAGAAAGAAGG + Intronic
1088582681 11:111330934-111330956 CTCTCCCTACCACAGAGGGATGG - Intergenic
1088792683 11:113240039-113240061 CCATCCTCTACACAGAAGAATGG + Intronic
1090011327 11:123048233-123048255 CCCCCATTTCCAAATAAGGAAGG - Intergenic
1090781241 11:130008687-130008709 CCTTCCTATGCACATAAGGAAGG + Intergenic
1091118079 11:133033336-133033358 CCCACCCCTGCACAGAAGGAGGG - Intronic
1094103773 12:26787379-26787401 CCAGCCTTTCACCAGAAGGATGG + Intronic
1097107059 12:56632194-56632216 CCCTCCTTTCTCCAGAAGGAAGG - Intronic
1097327554 12:58295755-58295777 CCGCCCTGTCCACAGAGGGAAGG + Intergenic
1098701463 12:73633029-73633051 CCCTCCCTTCCACAGACGTTAGG + Intergenic
1099894629 12:88629519-88629541 CCCTCATATGCACAGATGGATGG + Intergenic
1100589544 12:96012959-96012981 GCCTCCTTTCTGCACAAGGATGG - Intronic
1102222921 12:111206703-111206725 CCCACCTATCCACCCAAGGATGG + Intronic
1103518723 12:121523894-121523916 CCCTCCTCTGCACAGAAGCATGG + Intronic
1105787023 13:23759715-23759737 CACCCCTTTCCACAGAATGGAGG - Intronic
1108003741 13:45927395-45927417 CTCCTCTTTCCACAGCAGGATGG - Intergenic
1108209143 13:48120803-48120825 CCCTCCAATCAACAGAAGCATGG - Intergenic
1108772363 13:53719286-53719308 ACCTCCTTGCAAGAGAAGGAAGG + Intergenic
1109703673 13:66060369-66060391 CCCACCCTTCCACAGAAACAGGG + Intergenic
1110219409 13:73058252-73058274 CCCTCCTCCCCACACACGGATGG + Intronic
1113661294 13:112107916-112107938 CCCTCCTTTTGTCAGAAGGAGGG - Intergenic
1113661295 13:112107916-112107938 CCCTCCTTCTGACAAAAGGAGGG + Intergenic
1114411977 14:22509468-22509490 CCATCCTTTCCACCTAAGGGTGG - Intergenic
1116669478 14:47822207-47822229 CTCTCCTTTCCTCAAATGGAAGG + Intergenic
1117978761 14:61321891-61321913 CCCTCCTTTCCACCTCGGGAGGG + Exonic
1118213729 14:63788629-63788651 CCCGCCTTAACTCAGAAGGAGGG + Intergenic
1118394420 14:65323530-65323552 CTCTCCCTGCCACATAAGGAGGG + Intergenic
1119716819 14:76865667-76865689 CCCTCCATTCCAAAGTTGGAAGG - Intronic
1119719894 14:76883596-76883618 CCCACCTCTCCACAGCTGGAAGG + Intergenic
1120021751 14:79538780-79538802 CCCCCCATTTTACAGAAGGAGGG - Intronic
1120204499 14:81573335-81573357 TCCTCCTGGACACAGAAGGAGGG + Intergenic
1121880163 14:97492817-97492839 CCATCCTTTGCAGCGAAGGAAGG - Intergenic
1121912411 14:97803358-97803380 TCCTGCTTTCCACAGAGGAAAGG + Intergenic
1122205396 14:100145657-100145679 CCCTCCCTGCCAGAGAGGGATGG - Exonic
1122653495 14:103240745-103240767 CCCGCCATTCCCCAGGAGGAAGG + Intergenic
1122937156 14:104965582-104965604 CCCTCCTTGTCACTGCAGGAGGG - Intronic
1123116825 14:105898719-105898741 GCCTCCTGTGCACAGAAGCAGGG - Intergenic
1123118880 14:105907993-105908015 GCCTCCTGTGCACAGAAGCAGGG - Intergenic
1123121109 14:105917588-105917610 GCCTCCTGTGCACAGAAGCAGGG - Intergenic
1124216729 15:27813320-27813342 CCCTCCTGACCCCAGCAGGAGGG + Intronic
1125264770 15:37866452-37866474 CACTCCTTTCCCCAGAATTAAGG - Intergenic
1126729562 15:51668826-51668848 CCCTACTGTCTCCAGAAGGAAGG + Intergenic
1128129852 15:65219004-65219026 CCCTTTTTTCCTCAGAAGCAAGG + Intergenic
1128549731 15:68590462-68590484 CCCTGCTTCACACAGCAGGAAGG + Intronic
1128607558 15:69047978-69048000 CCCACCTTTGCACAGGAGGATGG - Intronic
1129059215 15:72847498-72847520 CCTTCCTTGCTTCAGAAGGAAGG - Intergenic
1129388255 15:75207498-75207520 CAGTCTCTTCCACAGAAGGAGGG + Exonic
1130987462 15:88854189-88854211 CCCTTTCTTCCTCAGAAGGATGG + Intronic
1131084026 15:89560256-89560278 ACCTCCTTACCACAGAGAGATGG - Intergenic
1131158513 15:90089680-90089702 TCCTACTTTCCACAGTTGGAGGG - Intronic
1134513012 16:14863907-14863929 CCCTGTTTCCCACAGAGGGAGGG - Intronic
1134648299 16:15888494-15888516 CCATCCTTTCCACAAGATGAAGG + Intronic
1134700650 16:16262396-16262418 CCCTGTTTCCCACAGAGGGAGGG - Intronic
1134971175 16:18532263-18532285 CCCTGTTTCCCACAGAGGGAGGG + Intronic
1135915667 16:26603583-26603605 CCCTCCTTCCCATAGTGGGAGGG - Intergenic
1137390405 16:48076379-48076401 CCATCCTTTCAATAGAAGAAAGG + Intergenic
1137484918 16:48882732-48882754 GCCTCCTGACCACAGCAGGATGG - Intergenic
1137589062 16:49682369-49682391 CCCTCCTTTCCTGAGCAGGAGGG - Intronic
1139847567 16:69931747-69931769 CTCTCCCTTCCACAGCAGGCAGG - Intronic
1140764361 16:78142668-78142690 TGCTACTTTCCACAGAAAGATGG + Intronic
1140884346 16:79229597-79229619 CGCCCCTGTCCACAGATGGATGG - Intergenic
1141495285 16:84405530-84405552 CCCGCCTTTGCACATGAGGAAGG + Intronic
1141587792 16:85046545-85046567 CCTTCCCTTCTACAGATGGACGG + Intronic
1141605970 16:85153609-85153631 CCCTCCTTTCTGCAGAGGGCAGG + Intergenic
1141695532 16:85617356-85617378 CCCTTCTTTCCACAGATGACTGG - Intronic
1141763085 16:86041809-86041831 CCCTGCTTTCCAGAAATGGAAGG - Intergenic
1142494535 17:299354-299376 CCCTCCCTCCCACGGAAGGCAGG + Intronic
1143908315 17:10227179-10227201 CACTCCTTTCCACAAAACCAGGG + Intergenic
1143924207 17:10355547-10355569 CTCTCCTTGGCTCAGAAGGAAGG + Intronic
1144936364 17:18902202-18902224 CCCACCTGTTCACAGAGGGATGG + Intronic
1145018463 17:19413383-19413405 CCCTTCTTTCCCCAGCAAGAAGG - Exonic
1145180485 17:20746047-20746069 CCATCATTTCTACAGAAAGAAGG - Intergenic
1145363039 17:22227943-22227965 CCCACCTTTCCAGAAAAGAAGGG - Intergenic
1146644386 17:34567422-34567444 CCTTCCCTTCCACAGCAGGCTGG + Intergenic
1146645904 17:34577613-34577635 CCCTCCCTTTCACAGTAGTATGG - Exonic
1146827701 17:36037706-36037728 CCCAGCTTTCCAAAAAAGGAGGG - Intergenic
1147453598 17:40520967-40520989 CCCTCCTATGCAATGAAGGAGGG + Intergenic
1147978148 17:44259574-44259596 CCCTCCTTCCCACAGGGAGATGG - Exonic
1149080234 17:52647545-52647567 CCCTCCTTCTCACAGGATGATGG + Intergenic
1149339439 17:55670623-55670645 CCCTCTTCTCTGCAGAAGGAGGG - Intergenic
1151057708 17:71052773-71052795 CCCTCCTTCTCAGAGAAGGGAGG + Intergenic
1152279035 17:79374395-79374417 CGGTCCTTTCCAAAGAAGAAAGG - Intronic
1152286144 17:79414392-79414414 TCCTCCTTTCCATAGGAAGATGG + Intronic
1155466410 18:26140366-26140388 CTCTCCTTACCACACATGGATGG + Intronic
1156290838 18:35747735-35747757 CCCTGTTTACCACAGAGGGAAGG - Intergenic
1157280518 18:46344060-46344082 TCCTCCCTGCCAGAGAAGGAGGG + Intronic
1157979084 18:52359558-52359580 TCCTACTTTCCAGAGAAAGAAGG - Intronic
1160544951 18:79647172-79647194 AACTCCTTTCCAAGGAAGGAAGG + Intergenic
1162751171 19:12830302-12830324 CCCTTCTTTTCTCAGAATGAAGG + Intronic
1165253506 19:34558816-34558838 CACTTCTTGCCACATAAGGACGG + Intergenic
1166537270 19:43582177-43582199 CCCTCTCTTCCTCAAAAGGAGGG - Intronic
1166586321 19:43952208-43952230 CTCCAATTTCCACAGAAGGAGGG + Intronic
1167142289 19:47660412-47660434 CCCTTTTTTCCAAATAAGGATGG + Intronic
1167264687 19:48477794-48477816 GCCTCCTGCCCACAGGAGGAGGG + Intronic
1168592140 19:57645997-57646019 GCCTCCTTCCCACAGAACCAGGG + Intergenic
925012222 2:494886-494908 CCCTCTTTCTCAGAGAAGGAGGG + Intergenic
926111627 2:10187656-10187678 CCCTGTTTTACACACAAGGAAGG - Intronic
926141921 2:10372942-10372964 CCCTCCTGCCCCCAGAAGGAGGG + Intronic
928115444 2:28542633-28542655 CCCTCCCTTCCAGAGATGGATGG - Intronic
928691742 2:33806672-33806694 CCCACCTTCCCAAAAAAGGAAGG - Intergenic
931242507 2:60466135-60466157 CCCACCTTCCCACAAAGGGAGGG - Intronic
931747223 2:65300762-65300784 TCATCCCTTCCTCAGAAGGAGGG - Intergenic
932423694 2:71615782-71615804 CCCTCCTGTCCCCAGAAGCCAGG - Intronic
934550596 2:95259114-95259136 CCCTCCTTTCTCCAGAAGAAAGG - Intronic
934752101 2:96799980-96800002 CCCTCCTGTCCTCAGGAGCAGGG - Intronic
934772153 2:96913899-96913921 CCCTCCTCTGCACAGAAGCCGGG - Intronic
937064193 2:119005033-119005055 AGCTCCTTTCCCCAGAAGCAAGG + Intergenic
937147466 2:119659857-119659879 CCTTCCTCTCCACAGAAGCAGGG - Intronic
938733505 2:134164934-134164956 GCCTCCTTACCACAGAATTAAGG - Intronic
939405118 2:141746046-141746068 CCCTCCTCTCCCCAAGAGGAAGG + Intronic
939999740 2:148955098-148955120 CCCTCCTTCCCTCACAAGCAGGG + Intronic
946163208 2:217848382-217848404 CCCTCCTGTGCAGAGTAGGAGGG + Exonic
946180884 2:217948322-217948344 CCCTCCATCACAGAGAAGGAAGG + Intronic
947738653 2:232474456-232474478 CCCTCCTCTCCACAGGGAGAAGG + Intergenic
947825150 2:233100757-233100779 GCCTCCTTTCCCCAGAGGGCAGG + Intronic
948966100 2:241381528-241381550 CCCTCTTCTCCACAGCTGGAAGG + Intronic
1168835118 20:872765-872787 CCCTCCATGTCACAGACGGAGGG + Exonic
1170383979 20:15795868-15795890 GCCTCCTGTCCACAGAAGGCTGG + Intronic
1170809259 20:19660933-19660955 CCCTGCTGTCAACAGGAGGAAGG + Intronic
1171416273 20:24982770-24982792 CCCTTCTTTACAGAGCAGGATGG - Intronic
1172022723 20:31925681-31925703 CCCTCCTTTCCCCAGGTGGAGGG - Intronic
1172286082 20:33741321-33741343 CTATTCTTTCCACAGAAGGGAGG - Intronic
1175538964 20:59736412-59736434 CACACCTGTCCACAGAGGGAAGG - Intronic
1176163208 20:63659022-63659044 GCGTCTTTTCCAGAGAAGGACGG + Intronic
1176416030 21:6475235-6475257 CACTCCTCTCCAGGGAAGGATGG - Intergenic
1176717365 21:10364490-10364512 CCCTCCTTTTCACCTCAGGAGGG - Intergenic
1176993576 21:15527095-15527117 CCCTTCTTTCCAGAGGAAGAAGG + Intergenic
1178817682 21:35946511-35946533 CCCTGCTTCCCACAGAGGAAGGG + Intronic
1179251236 21:39673391-39673413 CCCACCTTGCCACAGGGGGATGG - Intergenic
1179691530 21:43083569-43083591 CACTCCTCTCCAGGGAAGGATGG - Intergenic
1180093530 21:45544025-45544047 GACCCCTTCCCACAGAAGGATGG + Intronic
1180298589 22:11017410-11017432 CCCTCCTTTTCACCTCAGGAGGG - Intergenic
1180600977 22:17015503-17015525 CCCTCCTTTTCACCTCAGGAGGG + Intergenic
1181637826 22:24182418-24182440 CCCTCCTCTCCCCAGAAAGGAGG + Intronic
1183511388 22:38237184-38237206 CCCTCATTCCCCCACAAGGAAGG + Intronic
1183952485 22:41359396-41359418 CCCTCCTAATCACACAAGGATGG - Exonic
1184251251 22:43261594-43261616 CTGTCCTCTCCACAGAAAGATGG + Intronic
949949491 3:9217485-9217507 CCCTCCTCCCCGCAAAAGGAAGG + Intronic
950060538 3:10067894-10067916 ACCTCCTATCAACAGAATGAAGG + Intronic
950273164 3:11635396-11635418 CCTTCATTTCCCCTGAAGGAAGG + Intronic
950809663 3:15639073-15639095 ACCTTCATTCCTCAGAAGGAAGG + Intronic
953475555 3:43202972-43202994 CCCTCATTTACAGAGGAGGATGG + Intergenic
953690939 3:45118736-45118758 CCCTCCTTTTCTGAGAAGAAGGG + Intronic
954224289 3:49172458-49172480 CCCTCCTTCCCACTCCAGGAGGG + Intronic
954918840 3:54172073-54172095 CACTCCTTTGCACAGAAGAGCGG + Intronic
955406762 3:58630618-58630640 CACTCCTTCCCACAGCAGCAAGG + Intergenic
956532195 3:70232829-70232851 CTCTCCTTTGTACAGAAAGAAGG + Intergenic
958876624 3:99624427-99624449 CTCTCCTTTCCTCAAGAGGAAGG - Intergenic
959027562 3:101257936-101257958 TCCTCCTTCCCAGAGAATGAGGG + Intronic
961308328 3:125975467-125975489 ACCTCCTTCCCTCAGAAGAAGGG + Intronic
961590893 3:127980672-127980694 TCCTCCTGGCCACAGAAGGATGG - Intronic
964480256 3:157132249-157132271 CCCTCTTTTCCTGAGAAGGCAGG + Intergenic
964879700 3:161410002-161410024 CCCTCCTTTCCACAGCACCTGGG + Intergenic
967219525 3:187236915-187236937 CCTGCCTTTCTAGAGAAGGAAGG - Intronic
969395783 4:6920230-6920252 CCCTCCTTCCCAGAGATTGAAGG - Intronic
969597464 4:8157516-8157538 CCCTCCAATCCAAGGAAGGAGGG - Intronic
971709332 4:30091592-30091614 TCCTCCTTTCCCTAGAAGAAAGG - Intergenic
972386034 4:38566666-38566688 CCCTGCTTTCCAATGATGGAGGG + Intergenic
972636276 4:40886770-40886792 TCCTCCTTTGCACAGCAGGCAGG + Intronic
973159226 4:46994287-46994309 CCCTCCTCTCCAGAAAAGGATGG - Exonic
973606642 4:52593612-52593634 CACTCCCTGCCCCAGAAGGAGGG - Exonic
976184924 4:82433958-82433980 TCCATCATTCCACAGAAGGAAGG - Intronic
977587229 4:98787110-98787132 TCCTCATTTCCACGGAAGTAAGG - Intergenic
979100297 4:116604181-116604203 CCCTTCCTTCCACTTAAGGAAGG - Intergenic
980661124 4:135859500-135859522 CATTCCTTTCCAAAGAAGGGTGG + Intergenic
982032490 4:151314705-151314727 TCCTCCTTTACTTAGAAGGAAGG - Intronic
984680430 4:182602088-182602110 CGCTCCTGTCCAAAGAAAGAAGG - Intronic
984890206 4:184485164-184485186 CGCTCCTTTCCAAACAAAGAAGG + Intergenic
985472597 5:54782-54804 GCCTCATTTGCACAGAAGCATGG - Intergenic
985894680 5:2741162-2741184 CCCACCTTTCCCCAGTAAGAAGG + Intergenic
986024960 5:3842081-3842103 CCCCCAGTTCCCCAGAAGGAAGG - Intergenic
986224536 5:5800769-5800791 CCCACCAGACCACAGAAGGAGGG + Intergenic
986234192 5:5892535-5892557 CCTCCTTTTCCACAAAAGGAAGG + Intergenic
986706019 5:10455499-10455521 GCCTCTTTCCCACAGAGGGAGGG - Intronic
987369838 5:17182783-17182805 CCCTCCTCTCCCCACAATGAGGG - Intronic
988702741 5:33691626-33691648 CCCATCTTTCCACAGATAGAAGG - Intronic
998165172 5:139838613-139838635 CCCTCCTGTCCCCAGGAGCAAGG + Exonic
998452573 5:142246173-142246195 CCCTCCTTTCCAGAGGGGAAAGG + Intergenic
998757884 5:145400671-145400693 CCCTCCTTCCCACAGACTGGTGG - Intergenic
999970139 5:156850778-156850800 CCCTCCTTACCATAGTATGATGG + Intergenic
1001195942 5:169673772-169673794 CTTTCCCTTACACAGAAGGATGG + Intronic
1001831057 5:174789785-174789807 TCCTCCTATACACACAAGGATGG - Intergenic
1002812228 6:641493-641515 CCCGCCTCTCCACAGGAGGTTGG - Intronic
1003940062 6:11015713-11015735 CCCACCTACCCACAGAAGGCAGG - Intronic
1007274220 6:40661602-40661624 CCCTCCCTCCCACTGCAGGAAGG - Intergenic
1010112738 6:72259966-72259988 CGCTACTTTCCACAGTAGGATGG - Intronic
1010645054 6:78377200-78377222 ACATCCTATCAACAGAAGGAAGG + Intergenic
1013132336 6:107245191-107245213 CCATCCTTTCCCCAGAGGAAGGG - Intronic
1013161557 6:107550006-107550028 CCCTCCTCTCCACACCTGGAAGG + Intronic
1013642285 6:112097127-112097149 CTGGCCTTTCCACAGAAGGCTGG - Exonic
1014794661 6:125710707-125710729 TCCTCTTTTAAACAGAAGGAAGG - Intergenic
1015389889 6:132669855-132669877 CACTCCTTTCTAGAGGAGGAAGG - Intergenic
1016898736 6:149079680-149079702 CTCGCCTTTCCACAGAGGGAGGG + Intergenic
1018987565 6:168649304-168649326 CCGTCCTCACCACAGCAGGAAGG - Intronic
1019839005 7:3420085-3420107 CTTTCCTTTGCACAGAAGTATGG - Intronic
1020666820 7:11055025-11055047 CCCTGTTTACCACAGAAGAATGG + Intronic
1021245043 7:18251166-18251188 CACTCCTTTCTACAGATGCATGG - Intronic
1021537236 7:21719731-21719753 CCTTCCTTGCCACAGAAGATGGG - Intronic
1021653190 7:22851300-22851322 CATTCCTTTCCAGAGAAGGAAGG - Intergenic
1022475762 7:30708498-30708520 TCCTCCTTTCCCCAGACGGAAGG - Intronic
1023126223 7:36957054-36957076 CCATCCTCTCCACAGAAACAAGG - Intronic
1024705484 7:51954311-51954333 CCTACCTATCCACAGAAGGGTGG + Intergenic
1025204710 7:56985515-56985537 CCCGCCTTTCCCCAGGAGGGTGG - Intergenic
1025667227 7:63591420-63591442 CCCGCCTTTCCCCAGGAGGGTGG + Intergenic
1026186711 7:68087515-68087537 CGGTCCTTTGCACAGAAGGCTGG - Intergenic
1027830473 7:83170600-83170622 CCCTACTCTCCCCAGAAAGATGG - Intergenic
1028404551 7:90461423-90461445 CCATCCTGCCCAGAGAAGGAAGG - Intronic
1029412147 7:100420541-100420563 ACATCCTTTCCACCAAAGGATGG - Intronic
1029605922 7:101599377-101599399 CCATCCATTCCCCAAAAGGAAGG + Intergenic
1030535555 7:110762054-110762076 CCTTCCTTTCCAAAGAATCACGG + Intronic
1030778302 7:113564418-113564440 CCCACCCTTCCACAGAAGCTGGG - Intergenic
1030865907 7:114701507-114701529 TCCTCTTTTCCACACAAGGTAGG + Intergenic
1031529774 7:122862431-122862453 CCCTCCTTGCCACAGAAGGTGGG + Intronic
1032197672 7:129798795-129798817 GCCTCCTGCCCAGAGAAGGAAGG - Intergenic
1032719356 7:134538127-134538149 TCTTCCTTTCCATAAAAGGAGGG + Intronic
1032724325 7:134576896-134576918 TCTTCCTTTCCATAAAAGGAGGG + Intronic
1032740057 7:134729859-134729881 CCCTGCTTTTCTCAGAAAGAAGG + Intergenic
1032780435 7:135161454-135161476 CCTTCTTTTCCACAGCATGATGG + Intronic
1033314106 7:140283527-140283549 CCCTCCTTGACCCAGAAGGCAGG - Intergenic
1035133252 7:156675302-156675324 CCCTCGTCTCCAAAGACGGAGGG - Intronic
1035582945 8:751345-751367 CGCTCCTTTCCACGAGAGGATGG - Intergenic
1035909188 8:3547001-3547023 CCCTCCTGTCCACAGATGTGGGG + Intronic
1036466172 8:8999520-8999542 ACCTCATCTCTACAGAAGGAAGG - Intergenic
1036607026 8:10316611-10316633 CCCTCCTTTCATCAAAAGGGAGG - Intronic
1038127430 8:24690389-24690411 CTGTAATTTCCACAGAAGGAGGG - Intergenic
1039235524 8:35498354-35498376 CTCTCTTCTTCACAGAAGGATGG - Intronic
1039417392 8:37407390-37407412 CACACCTTTGCACAGAGGGAGGG - Intergenic
1040095660 8:43440057-43440079 TCTTCCTTTCCTCAAAAGGAAGG - Intergenic
1040470092 8:47729642-47729664 ACCTCATTTCCACAGAGGAAAGG - Intronic
1041691887 8:60695119-60695141 GCCTCCTTTCGAGAGAAGTAAGG + Intronic
1047792872 8:128222696-128222718 GCCTCATTTCCACAGCAGGCTGG - Intergenic
1049653597 8:143788145-143788167 CCCTGCTTCCCAGAGCAGGAAGG + Intergenic
1049955523 9:689408-689430 CCCTGCCTTCCACATGAGGAGGG - Intronic
1050082308 9:1928181-1928203 ACATTATTTCCACAGAAGGATGG + Intergenic
1055483559 9:76734179-76734201 CCCTCCTTTCCACAGAAGGAGGG - Intronic
1057405711 9:94769012-94769034 CCTTCCCCTCCACAGAAGGCAGG - Intronic
1060751188 9:126170569-126170591 CCCTTCTTTCCACACGAGGCTGG - Intergenic
1060856779 9:126920491-126920513 CTCTCCTTTCCACAGAAGTATGG + Intronic
1061417114 9:130453140-130453162 CCCACCTTTCCCAAAAAGGAGGG + Intronic
1188008799 X:25037496-25037518 CTCTTCATTCCACAGAATGAAGG + Intergenic
1188446751 X:30261349-30261371 GCCTCATTAGCACAGAAGGATGG + Intergenic
1189109945 X:38278756-38278778 CCCCTCTTTTCACAGAGGGAGGG + Intronic
1189185707 X:39052978-39053000 TCCTCCTCACCTCAGAAGGAAGG + Intergenic
1190282228 X:48938757-48938779 CCCTCCTCTTCCCAGAAGGCTGG + Intronic
1190475531 X:50823457-50823479 CCCTCTTTTGCAGAGAAGGAAGG + Intergenic
1190702834 X:53000872-53000894 CCCACCTTTCGACAGTAGGGCGG - Intergenic
1191221881 X:57998297-57998319 CTCTCCTCTCTTCAGAAGGAAGG - Intergenic
1193406847 X:81110991-81111013 GCTTGCTTTCTACAGAAGGAGGG - Intergenic
1193555940 X:82953430-82953452 CCCTGCTTTCCTCAGTAGCAAGG + Intergenic
1197056265 X:122123442-122123464 TCCTCCTTCACAAAGAAGGATGG + Intergenic
1198956380 X:142136156-142136178 CTCTCCTCTCCTCAGGAGGAAGG - Intergenic
1199314228 X:146358360-146358382 CCCTCCTTCCTACAGGAGAAGGG + Intergenic