ID: 1055485092

View in Genome Browser
Species Human (GRCh38)
Location 9:76748853-76748875
Sequence TGCCCACGGTTCAGTACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055485089_1055485092 -6 Left 1055485089 9:76748836-76748858 CCATACATCGTAGGAGCTGCCCA 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1055485092 9:76748853-76748875 TGCCCACGGTTCAGTACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055485092 Original CRISPR TGCCCACGGTTCAGTACAGT GGG Intronic
No off target data available for this crispr