ID: 1055487211

View in Genome Browser
Species Human (GRCh38)
Location 9:76767857-76767879
Sequence GAGAATAGCCATAGTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 419}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055487211_1055487221 19 Left 1055487211 9:76767857-76767879 CCATGCCCACTATGGCTATTCTC 0: 1
1: 0
2: 0
3: 11
4: 419
Right 1055487221 9:76767899-76767921 CCCTCTTGGTTCCTCACTTTGGG No data
1055487211_1055487219 18 Left 1055487211 9:76767857-76767879 CCATGCCCACTATGGCTATTCTC 0: 1
1: 0
2: 0
3: 11
4: 419
Right 1055487219 9:76767898-76767920 ACCCTCTTGGTTCCTCACTTTGG No data
1055487211_1055487216 5 Left 1055487211 9:76767857-76767879 CCATGCCCACTATGGCTATTCTC 0: 1
1: 0
2: 0
3: 11
4: 419
Right 1055487216 9:76767885-76767907 CCCTGGCTTCCTAACCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055487211 Original CRISPR GAGAATAGCCATAGTGGGCA TGG (reversed) Intronic
901572299 1:10171378-10171400 GATAATAACCACAGTGGCCAGGG + Intronic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
906375008 1:45289106-45289128 GAAAATAGCCATACTGCCCAAGG + Intronic
906609745 1:47192986-47193008 CAGAAAAGCCAAAGTGGGCCTGG + Intergenic
907815344 1:57913001-57913023 GAAAATGGCCATACTGTGCAAGG + Intronic
908624224 1:66021895-66021917 GAAAATAGCCATATTGCCCAAGG - Intronic
908945255 1:69487878-69487900 GAAAATGGCCATAGTGCCCAAGG - Intergenic
908984170 1:69996982-69997004 GAAAATGGCCATATTGCGCAAGG - Intronic
909178435 1:72389477-72389499 GAAAATGGCCATACTGGCCAAGG - Intergenic
909343397 1:74556972-74556994 GAAAATAGCCATACTGCCCAAGG + Intergenic
911927452 1:103852603-103852625 GAGAATGGCCATACTGCCCAAGG - Intergenic
911993042 1:104726701-104726723 GATAAAAGCCATCCTGGGCAGGG - Intergenic
912758892 1:112348413-112348435 AAGAATAGCCATAATGGGCTGGG + Intergenic
912776794 1:112510525-112510547 GAGAAAAGCCACAGGGTGCAAGG - Intronic
912778311 1:112521028-112521050 GATGTTAGCCATAGTGGACAAGG + Exonic
915181790 1:154068003-154068025 GAAAATGGCCATAGTGCCCAAGG + Intronic
915741832 1:158124617-158124639 GAGAAAAGCCATAGGAGGTAAGG + Intergenic
916614445 1:166425039-166425061 GACAATGGCCATAGTGCCCAAGG - Intergenic
916868336 1:168885592-168885614 GAAAATAGCCATACTGCCCAAGG - Intergenic
917119935 1:171636560-171636582 GAGAATCGACACAGTTGGCACGG - Exonic
918418644 1:184338930-184338952 GAAAATGGCCATACTGGCCAAGG - Intergenic
918599959 1:186346143-186346165 AAGAAGAGCCATAGAGAGCATGG - Exonic
918735467 1:188056911-188056933 GAGAATAGCCTTAATGGACTAGG + Intergenic
919014680 1:192017580-192017602 GAAAATAGCCATACTGCCCAAGG + Intergenic
919229647 1:194757573-194757595 GAAAATAGCCATACTGCCCAAGG - Intergenic
920774625 1:208924087-208924109 GGGAAAAGCCATAGTGAGCGAGG - Intergenic
922005753 1:221529194-221529216 GAGAATAGCCATCATGGTGAAGG - Intergenic
923037843 1:230297540-230297562 GAAAATAGCCATACTGCCCAAGG + Intergenic
924012048 1:239676047-239676069 GAAAACAGGGATAGTGGGCATGG - Intronic
924129975 1:240896867-240896889 GAAAATGGCCATAGTGCCCAAGG - Intronic
1063528353 10:6805723-6805745 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1064912675 10:20420021-20420043 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1065675025 10:28165026-28165048 GAGAATCACCATATTGGCCAGGG - Intronic
1065799285 10:29336466-29336488 GAAAATGGCCATACTGGCCAAGG + Intergenic
1066404977 10:35109876-35109898 TAAAATATCCATAGTGGGCCAGG + Intergenic
1066724309 10:38374231-38374253 GAAAATGGCCATACTGGCCAAGG - Intergenic
1067194294 10:44102205-44102227 AAGAATAGCCTTGGTGGGGATGG + Intergenic
1067333803 10:45346020-45346042 GAAAATAGCCATACTGCCCAAGG + Intergenic
1068848868 10:61713089-61713111 GAAAATGGCCATAGTGCCCAAGG - Intronic
1068921304 10:62487538-62487560 GATCATAGCCATTGTTGGCAGGG + Intronic
1069263511 10:66430311-66430333 GAAAATGGCCATACTGGCCAAGG + Intronic
1071207287 10:83295997-83296019 GAAAATAGCCATACTGCCCAAGG + Intergenic
1073675916 10:105646901-105646923 GAGAATAGCAATGGTGAGCAGGG + Intergenic
1075710646 10:124528820-124528842 AAGAACAGCCCTAGAGGGCAGGG - Intronic
1076608454 10:131704564-131704586 GAGAATGGCCATACTGCCCAAGG + Intergenic
1078370011 11:10736584-10736606 GAGGTTAGCCAGAGGGGGCAGGG + Intergenic
1078794348 11:14576863-14576885 GAAAATGGCCATACTGCGCAAGG - Intronic
1079628755 11:22648507-22648529 GAAAATGGCCATACTGCGCAAGG - Intronic
1079664274 11:23084075-23084097 GAAAATGGCCATACTGCGCAAGG - Intergenic
1079776122 11:24530607-24530629 GAGACAAGCCATACTGGACATGG - Intronic
1081783137 11:45727358-45727380 GAGGGTAGCCACAGTGGGGAGGG + Intergenic
1082140229 11:48600360-48600382 GAAAATGGCCATAGTGCCCAAGG + Intergenic
1082303924 11:50547463-50547485 GAGAATGGCCATACTGCCCAAGG + Intergenic
1082568523 11:54710154-54710176 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1082574790 11:54789090-54789112 GAAAATAGCCATAGTGCCCAAGG + Intergenic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084983379 11:72845667-72845689 GAGAATAGAAATAGTGTGCAGGG - Intronic
1085498233 11:76992545-76992567 GACACAAGCCACAGTGGGCATGG - Intronic
1087822710 11:102730048-102730070 GAGAGTAGCTAGAGTGAGCATGG + Intergenic
1088274913 11:108074866-108074888 GAGTATAGACATGGTGGGCGTGG + Intronic
1090030858 11:123204954-123204976 GAAAATAGTCCTAGTGGGCCGGG - Intergenic
1090128457 11:124115219-124115241 GAGAACAGGCAAAGAGGGCAAGG - Intergenic
1091151160 11:133329241-133329263 GAGAATGGCCATACTGCCCAAGG + Intronic
1091419024 12:318868-318890 GAGAATGACCAGAGTGGGGAAGG + Intronic
1091966096 12:4743139-4743161 GAAAAGTACCATAGTGGGCATGG - Intronic
1092357977 12:7812353-7812375 GAGAATAGCAATATTTGGCCGGG - Intergenic
1093775743 12:23072215-23072237 GAAAATAGCCATACTGCCCAAGG - Intergenic
1096762468 12:53853513-53853535 GACAATAGCCTTATGGGGCATGG + Intergenic
1096765053 12:53879439-53879461 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1096895156 12:54814155-54814177 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1097408615 12:59223599-59223621 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1097910169 12:64960831-64960853 GATAATAGCCATTCTGGGCCAGG + Intergenic
1098666387 12:73168854-73168876 GAAAATAGCCATACTGCCCAAGG - Intergenic
1098677163 12:73304474-73304496 GAAAATAGCCATACTGCCCAAGG + Intergenic
1099755768 12:86846222-86846244 GAAAATGGCCATAGTGCCCAAGG + Intergenic
1099756672 12:86859364-86859386 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1100174763 12:92016818-92016840 GAAAATAGCCATACTGCCCAAGG - Intronic
1101598528 12:106188690-106188712 GAGAAGAGCCAGAGGGGGGAGGG + Intergenic
1101766666 12:107706983-107707005 GAAAATAGCCATACTGCCCAAGG - Intronic
1105963295 13:25362401-25362423 GAAAATAGCCATATTGCCCAAGG + Intergenic
1107154573 13:37151538-37151560 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1107766612 13:43742072-43742094 AAGAATAGACAAAATGGGCAAGG + Intronic
1109329610 13:60912240-60912262 CAGAATAGCCATAAAGCGCATGG + Intergenic
1109357327 13:61247578-61247600 GAGAAGAGCCTTGTTGGGCAGGG + Intergenic
1109565933 13:64116476-64116498 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1110660011 13:78049220-78049242 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1112093743 13:96110010-96110032 GAGCATAGCCAGAGTGGGAGAGG + Intronic
1112824344 13:103374761-103374783 GAAAATAGCCATACTGCCCAAGG + Intergenic
1113206418 13:107922255-107922277 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1113405957 13:110040570-110040592 GAAAATGGCCATACTGGCCAAGG + Intergenic
1113407008 13:110050839-110050861 GAAAATGGCCATACTGGCCAAGG + Intergenic
1113590678 13:111497687-111497709 GAAAATAGCCATACTGCCCAAGG - Intergenic
1114932738 14:27493994-27494016 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1114945679 14:27677487-27677509 GAAAATAGCCATACTGCCCAAGG + Intergenic
1115833837 14:37374966-37374988 GAAAATAGCCATATTGCCCAAGG - Intronic
1116323230 14:43496597-43496619 GAAAATAGCCATACTGCCCAAGG + Intergenic
1116404667 14:44553133-44553155 GAAAATAGCCATACTGCCCAAGG - Intergenic
1116483166 14:45415953-45415975 GAAAATAGCCATACTGCCCAAGG + Intergenic
1118044530 14:61952340-61952362 GAGAATAGCTGAAGTGTGCAGGG + Intergenic
1118482944 14:66185316-66185338 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1118484866 14:66205014-66205036 GAAAATGGCCATAGTGCCCAAGG + Intergenic
1120535687 14:85692101-85692123 GAGAAGACCCATATTTGGCATGG + Intergenic
1120777865 14:88457308-88457330 GAAAATGGCCATAGTGCCCAAGG - Intronic
1121239782 14:92420785-92420807 GAGAATACCCACGGTGGGCATGG + Intronic
1124655525 15:31503906-31503928 GATAATATCCAGAGTGGGGAGGG - Intronic
1126147688 15:45492003-45492025 GATAATAGCCAGAGTTAGCAAGG + Intronic
1128325649 15:66722471-66722493 GGGGATAGGCAGAGTGGGCATGG - Intronic
1130818672 15:87468143-87468165 GAAAATGGCCATAGTGCCCAAGG + Intergenic
1131203135 15:90417796-90417818 GAAAATGGCCATACTGAGCAAGG - Intronic
1132152244 15:99470711-99470733 GAGAATAGTCATTGTGAGCAGGG - Intergenic
1136606998 16:31342433-31342455 GAAAATGGCCATACTGGCCAAGG + Intergenic
1136653256 16:31691719-31691741 GAAAATGGCCATAGTGCCCAAGG + Intergenic
1136987127 16:35117837-35117859 GAAAATAGCCATACTGCCCAGGG + Intergenic
1137025805 16:35473087-35473109 GAAAATGGCCATACTGCGCAAGG + Intergenic
1137316262 16:47326882-47326904 GAAAATGGCCATAGTGCCCAAGG + Intronic
1137347627 16:47679353-47679375 GAAAATGGCCATAGTGCCCAAGG - Intronic
1137681279 16:50347818-50347840 GAAAATGGCCATAGTGCCCAAGG + Intronic
1138168766 16:54829700-54829722 GAGCAAGGCCAGAGTGGGCACGG - Intergenic
1138589371 16:57991372-57991394 GAGAAAATCAATAGTGGCCAAGG + Intergenic
1139078420 16:63483758-63483780 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1140065181 16:71605535-71605557 GAAAATGGCCATAGTGCCCAAGG + Intergenic
1142935611 17:3328140-3328162 GAAAATGGCCATACTGCGCAAGG - Intergenic
1146752911 17:35398350-35398372 GAAAATGGCCATAGTGTCCAAGG + Intergenic
1146953033 17:36919881-36919903 GACAATAGCCAGAGAGGACAAGG - Intergenic
1149642456 17:58212507-58212529 AAGAAAAGCAATAGTGGGAAGGG + Intronic
1149664169 17:58354261-58354283 GAGAATAAGAATAGTGGGGAGGG - Exonic
1155681282 18:28490043-28490065 GAAAATGGCCATAGTGCCCAAGG + Intergenic
1157123025 18:44929518-44929540 GAGAATGGCCATATTGCCCAAGG - Intronic
1157151789 18:45225575-45225597 GAGAATGGCCATACTGCCCAAGG - Intronic
1157561865 18:48653533-48653555 GAAAATAGCCATACTGCCCAAGG + Intronic
1157916641 18:51670118-51670140 GAGAGCAGACATAGTGAGCAAGG + Intergenic
1158449490 18:57551065-57551087 GAGAAAAGGCCTAGTGGGTAGGG - Intronic
1159569829 18:70100163-70100185 GAAAATGGCCATACTGGCCAAGG - Intronic
1160276791 18:77444515-77444537 CAGTATAGCCATCGCGGGCATGG + Intergenic
1161853419 19:6750636-6750658 GAGAACGGCCAGAGTGGGCTTGG + Intronic
1163941131 19:20495009-20495031 GAAAATAGCCATACTGCCCAAGG + Intergenic
1164347298 19:27282139-27282161 GAAAATAGCCATATTGCCCAAGG - Intergenic
1165304356 19:34994622-34994644 GAGAAAGGACAGAGTGGGCATGG - Intergenic
1165451181 19:35884320-35884342 GAGGATGGCCATCTTGGGCAGGG - Intergenic
1165460110 19:35939415-35939437 GAGGATGGCCATCGCGGGCAGGG - Exonic
1167473989 19:49689827-49689849 GTGGATAGTCATCGTGGGCAGGG - Exonic
1167808213 19:51804893-51804915 GAGAAAAGCGATAGTGAGAAGGG + Intronic
1168288966 19:55347754-55347776 GAGCAAAGCCATAAGGGGCAGGG + Exonic
925584706 2:5453184-5453206 AAGAATACACATAGAGGGCAGGG + Intergenic
926673503 2:15598412-15598434 GAGAATAACCATAGTGATAATGG + Intronic
926692840 2:15748986-15749008 GACAAGAGCAAGAGTGGGCAGGG - Intergenic
926942360 2:18151879-18151901 GAGAATAGCCATGTTGACCAGGG - Intronic
927695089 2:25234427-25234449 GAGAAAAGGCAGAGAGGGCAGGG + Intronic
928475768 2:31625944-31625966 GAAAATGGCCATAGTGCCCAAGG - Intergenic
928486930 2:31741740-31741762 GAAAATGGCCATAGTGCCCAAGG - Intergenic
928487971 2:31751867-31751889 GAAAATGGCCATAGTGCCCAAGG + Intergenic
929114012 2:38429140-38429162 GGGAATAGCCAGGGTGGGGATGG + Intergenic
929186866 2:39104451-39104473 GAAAATAGCAAGTGTGGGCAAGG + Intronic
929543794 2:42842557-42842579 GACAAACGCCATAGTGGGCGAGG - Intergenic
930045276 2:47165381-47165403 GTGAATACCCCTTGTGGGCATGG - Intronic
930673288 2:54174115-54174137 GAAAATAGCCATACTGCCCAAGG - Intronic
930814351 2:55576920-55576942 TAGAATAGGCATAGTAGGTATGG - Intronic
931300544 2:60974160-60974182 GAGAAGACCCACAGTGGGTAGGG - Intronic
931519751 2:63082651-63082673 CAGAATACCCATGGGGGGCAGGG + Intergenic
931520303 2:63089258-63089280 GAAAATGGCCATAGTGCCCAAGG - Intergenic
934481460 2:94650019-94650041 TAGAATACCCACAGTGTGCAAGG - Intergenic
937063342 2:118996922-118996944 GAAAATAGCCATACTGCCCAAGG - Intergenic
937186359 2:120047244-120047266 GAAAATAGCCATACTGCCCAAGG - Intronic
937189581 2:120081692-120081714 GAAAATAGCCATACTGCCCAAGG - Intronic
937807821 2:126166563-126166585 GAAAATGGCCATAGTGCCCAAGG - Intergenic
938015103 2:127860229-127860251 CAGAATAGCCATACTGGGGGAGG + Intergenic
939402928 2:141718007-141718029 GAGAATGGCCACTGTGGCCATGG + Intronic
940240521 2:151558423-151558445 GAAAATAGCCATACTGCCCAAGG + Intronic
940544430 2:155065194-155065216 GAAAATAACCATAGTGCCCAAGG - Intergenic
941046472 2:160681429-160681451 GAGAATAACCAGTGTTGGCAAGG - Intergenic
941120781 2:161527793-161527815 GAAAATAGCCATACTGCCCAAGG - Intronic
941174790 2:162183413-162183435 AAGAATAGCCATATGGGGCTGGG - Exonic
941943190 2:171065830-171065852 TAGAATAGCCAGAGAGGGCTGGG - Intronic
942467091 2:176219749-176219771 GAAAATGGCCATAGTGCCCAAGG - Intergenic
942716770 2:178902163-178902185 GAAAATGGCCATAGTGCCCAAGG + Intronic
943234106 2:185295491-185295513 GAAAATGGCCATAGTGCCCAAGG + Intergenic
943286920 2:186013330-186013352 GAAAATGGCCATAGTGCCCAAGG + Intergenic
944086145 2:195850168-195850190 GAGAATAACCAAAATGAGCATGG + Intronic
944168086 2:196744177-196744199 GAGAATGGCCATACTGCCCAAGG - Intronic
945988982 2:216377646-216377668 GAGAAGAGCCAGAGAGAGCAAGG - Intergenic
946047171 2:216830851-216830873 GACAAAAGCCATACTGGCCATGG + Intergenic
946795259 2:223344360-223344382 GAAAATGGCCATAGTGCCCACGG - Intergenic
947241827 2:228003150-228003172 GAAAATAGCCATACTGCCCAAGG - Intronic
948026274 2:234780040-234780062 GAAAATGGCCATACTGCGCAAGG + Intergenic
1168860329 20:1041715-1041737 GGGAAGAGCCATAGGAGGCAGGG - Intergenic
1169902230 20:10565257-10565279 GAGACTAGCCAGAGTGGGTCTGG + Intronic
1170049361 20:12125297-12125319 GAAAATGGCCATACTGGCCAAGG - Intergenic
1170127238 20:12977316-12977338 GAGATTAGACATAGTAGGGAAGG + Intergenic
1170186618 20:13598090-13598112 GAAAATGGCCATAGTGCCCAAGG + Intronic
1170738852 20:19035317-19035339 GAAAATGGCCATACTGGCCAAGG + Intergenic
1171337526 20:24398087-24398109 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1171352616 20:24515746-24515768 GAAAATGGCCATAGTGCCCAAGG + Intronic
1172813879 20:37671082-37671104 GTGAACACCCACAGTGGGCAAGG - Intergenic
1177002500 21:15631833-15631855 GAGAATCATCATATTGGGCATGG - Intergenic
1178927718 21:36790085-36790107 GATAATACCCAGGGTGGGCAAGG - Intronic
1181472780 22:23151180-23151202 CAGAATAGCCGAAGTGGCCATGG + Intronic
1181922957 22:26334792-26334814 GAGAAGGGCCAGAGTGGGCAGGG + Intronic
1182197439 22:28533466-28533488 GAAAATAGCCATACTGCTCAAGG + Intronic
1184080222 22:42214104-42214126 GAGAATCTCCAGTGTGGGCAAGG - Exonic
1184931041 22:47681670-47681692 GAGAAGGGCCATAGAAGGCATGG + Intergenic
951123710 3:18959389-18959411 GAAAATGGCCATAGTGCACAAGG - Intergenic
951174528 3:19583702-19583724 GAAAATGGCCATACTGGCCAAGG + Intergenic
951176267 3:19604387-19604409 GAGAATAGGCATAGTGGATTTGG + Intergenic
951440581 3:22718722-22718744 GAAAATAGCCATACTGCCCAAGG + Intergenic
951468695 3:23032000-23032022 GAAAATGGCCATACTGTGCAAGG - Intergenic
951684895 3:25333084-25333106 GAAAATGGCCATAGTGCCCAAGG + Intronic
952005816 3:28841347-28841369 AAGAATAGTCATAGTGGTTATGG - Intergenic
952574913 3:34763045-34763067 GAAAATGGCCATAGTGCCCAAGG + Intergenic
953011479 3:39029519-39029541 GGGAAAGGACATAGTGGGCAGGG + Intergenic
953053523 3:39368221-39368243 GAAAATAGCCATACTGCCCAGGG - Intergenic
954890500 3:53923332-53923354 GAGAATGGCCATACTGCCCAAGG - Intergenic
954982407 3:54758417-54758439 GAGAATGGACATTGAGGGCAGGG - Intronic
955018916 3:55099463-55099485 GAGAATGGCCATACTGCCCAAGG + Intergenic
956313179 3:67904735-67904757 GAAAATAGCCATACTGCCCAAGG - Intergenic
956461455 3:69476787-69476809 GAAAATAGCCATACTGCCCAAGG - Intronic
957871702 3:86097498-86097520 GAAAATGGCCATACTGGCCAAGG + Intergenic
957917467 3:86704880-86704902 GAAAATAGTCATATTGCGCAAGG - Intergenic
957972894 3:87405701-87405723 GAAAATGGCCATACTGGCCAAGG + Intergenic
958954364 3:100451343-100451365 GGGAAAACCCAAAGTGGGCAGGG + Intronic
959535017 3:107474922-107474944 GAAAATAGCCATACTGCCCAAGG + Intergenic
960339710 3:116459691-116459713 GAAAATAGCCATACTGCCCAAGG + Intronic
962155781 3:132947590-132947612 GAAAATGGCCATAGTGCCCAAGG - Intergenic
962348637 3:134640875-134640897 GAGAATAAACAGAGGGGGCAAGG - Intronic
962441542 3:135422988-135423010 GTGAATACCCATTGTGGACAGGG - Intergenic
962624849 3:137215574-137215596 GAAAATAGCCATACTGCCCAAGG + Intergenic
963635822 3:147794372-147794394 TAGAGTAGCCATAGTGGGTGTGG - Intergenic
964429618 3:156591224-156591246 GAAAATAGCCATACTGCCCAAGG - Intergenic
964602993 3:158523784-158523806 GAGCATGGTCATAGTGGGGAAGG + Intronic
964657700 3:159086500-159086522 GAAAATAGCCATACTGCCCAAGG - Intronic
965060064 3:163773675-163773697 GATAGTAGCCAGAGTTGGCAAGG - Intergenic
965683760 3:171279541-171279563 GCCAATAGCCAGAGTTGGCAAGG - Intronic
966352204 3:179043131-179043153 GAAAATAGCCATACTGCCCAAGG + Intronic
968002644 3:195217721-195217743 GAAAATAGCCATACTGCCCAAGG + Intronic
970067032 4:12107262-12107284 GAGATTAGCCATAGATGGGATGG - Intergenic
971888493 4:32484286-32484308 GAGAATAACTAGAGTGGGCCAGG - Intergenic
972001629 4:34043309-34043331 AAGAAGAGCCAAAATGGGCAAGG + Intergenic
972825231 4:42750612-42750634 GAGAGTGTCAATAGTGGGCAAGG + Intergenic
972967856 4:44534348-44534370 GAAAATAGCTATAGTAGTCAGGG - Intergenic
973139736 4:46752001-46752023 GAAAATAGCCATACTGCCCAAGG - Intronic
973631029 4:52820881-52820903 GAAAATAGCCATACTGCCCAAGG + Intergenic
973660219 4:53097298-53097320 GAAAATAGCCATACTGCCCAAGG - Intronic
974254515 4:59431782-59431804 GAAAATGGCCATAGTGACCAAGG + Intergenic
975100158 4:70503683-70503705 AAGAATAGCCATACTAGGCTGGG - Intergenic
975274393 4:72479101-72479123 GAGAATGGCCATACTGCCCAGGG + Intronic
975277235 4:72516419-72516441 GAGAATGGCCATACTGCCCAAGG - Intronic
975284220 4:72598258-72598280 GAGAATGGCCATACTGCCCAAGG + Intergenic
975474626 4:74809259-74809281 GAAAATGGCCATACTGGCCAAGG + Intergenic
975887002 4:78978013-78978035 GAAAATGGCCATAGTGCCCAAGG - Intergenic
975904547 4:79193809-79193831 GAAAATGGCCATACTGCGCAAGG - Intergenic
976450976 4:85190596-85190618 GAAAATGGCCATACTGGCCAAGG - Intergenic
976684486 4:87796961-87796983 GAAAATAGCCATACTGCCCAAGG + Intergenic
977137481 4:93323630-93323652 GAAAATGGCCATAGTGCCCAAGG - Intronic
977616755 4:99095518-99095540 GAAAATGGCCATACTGGCCAAGG - Intergenic
977653579 4:99496666-99496688 GAGAATGGCCATACTGCCCAAGG + Intergenic
977857147 4:101907963-101907985 GAAAATAGCCATACTGCCCAAGG + Intronic
980696393 4:136362102-136362124 GAAAATAGCCATACTGCCCAAGG + Intergenic
981255160 4:142652770-142652792 GAAAATAGCCATATTGCCCAAGG + Intronic
981560553 4:146043842-146043864 GAAAATAGCCATACTGCCCAAGG - Intergenic
982258645 4:153473929-153473951 GAGAGCACCCAAAGTGGGCAGGG - Intronic
982479836 4:155895802-155895824 GAAAATGGCCATACTGGCCAAGG + Intronic
982888957 4:160822620-160822642 GAGAATGGCCATACTGCCCAAGG + Intergenic
983148430 4:164246008-164246030 GAAAATGGCCATACTGGCCAAGG + Intronic
983458419 4:167994936-167994958 GACAAAAGCCATAGTAGGCCTGG - Intergenic
983653629 4:170057658-170057680 AAGCATAGCCATAGTTGGCCAGG - Intergenic
984492209 4:180449090-180449112 GAAAATAGCTAGAGTTGGCAAGG + Intergenic
984677522 4:182567364-182567386 GAGAACAGACGTGGTGGGCATGG - Intronic
985242918 4:187949827-187949849 GAAAATGGCCATAGTGCCCAAGG - Intergenic
985243391 4:187955108-187955130 GAAAATGGCCATAGTGCCCAAGG + Intergenic
986490548 5:8285227-8285249 GAAAATAGCCATACTGCCCAAGG + Intergenic
987249616 5:16085528-16085550 GATGATATCCATAGTTGGCATGG + Intronic
988170072 5:27641956-27641978 GAAAATGGCCATACTGCGCAAGG + Intergenic
988514324 5:31891640-31891662 GAGAAGTGGCATTGTGGGCAGGG + Intronic
989449108 5:41566115-41566137 GAAAATGGCCATACTGGCCAAGG - Intergenic
989525216 5:42445976-42445998 GAGAGAAGCCATAGTTGTCAGGG + Intronic
989673985 5:43952749-43952771 GAAAATGGCCATAGTGCCCAAGG - Intergenic
989728942 5:44624664-44624686 GAAAATGGCCATACTGCGCAAGG + Intergenic
989845487 5:46135415-46135437 GAAAATGGCCATAGTGCCCAAGG + Intergenic
989959301 5:50391530-50391552 GAGAATGGCCATACTGCCCAAGG + Intergenic
989994571 5:50813176-50813198 GAAAATAGCCATACTGCCCAAGG - Intronic
990274676 5:54182732-54182754 GAAAATAGCCATACTGCCCAAGG - Intronic
990276109 5:54198704-54198726 GAAAATAGCCATACTGCCCAAGG + Intronic
990340469 5:54817503-54817525 GAAAATAGCCATACTGCCCAAGG + Intergenic
990656999 5:57968206-57968228 GAAAATAGCCATACTGCCCAAGG - Intergenic
993435184 5:87884159-87884181 GAAAATGGCCATAATGCGCAAGG - Intergenic
993676125 5:90817997-90818019 GAAAATGGCCATAGTGCCCAAGG - Intronic
994161299 5:96559762-96559784 GAGAATGGCTATAGTGCCCAAGG + Intronic
994645948 5:102469245-102469267 GAAAATAGCCATACTGCCCAAGG - Intronic
994970273 5:106729261-106729283 GAAAATGGCCATAGTGCCCAAGG - Intergenic
996274347 5:121646257-121646279 GAGAATGGCCATACTGCCCAAGG - Intergenic
996598345 5:125231055-125231077 AAGAATAGCCATTCTGGGCTGGG + Intergenic
997112601 5:131091697-131091719 GAAAATAGCCATACTGCCCAAGG + Intergenic
997116848 5:131134509-131134531 GAAAATAGCCATACTGCCCAAGG - Intergenic
997172100 5:131732912-131732934 GAAAATAGCCATACTGCCCAAGG - Intronic
997496620 5:134332877-134332899 GAAAATGGCCATACTGGCCAAGG - Intronic
998257807 5:140602078-140602100 GAGAATAGAAATAGTAGGAAAGG - Intergenic
999106692 5:149077724-149077746 GAAAATAGCCATACTGCCCAAGG + Intergenic
1000271274 5:159685665-159685687 GAAAATGGCCATACTGGCCAAGG - Intergenic
1000397254 5:160788729-160788751 GTGAATAGCTACAGTGGGTAAGG + Intronic
1000411939 5:160942665-160942687 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1000708216 5:164537906-164537928 GAAAATAGCCATAGTGCCCAAGG + Intergenic
1001071998 5:168594129-168594151 GAAAATAGCCATACTGCCCAAGG - Intergenic
1001076795 5:168635430-168635452 GAAAATAGCCATACTGCCCAAGG + Intergenic
1002127114 5:177054359-177054381 AAAAATAGCCAGATTGGGCATGG - Intronic
1004291080 6:14368141-14368163 TAGAAAAGCCACAGTGGGCAGGG + Intergenic
1004457774 6:15807164-15807186 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1004515829 6:16321553-16321575 GAGAAAAGCTGTACTGGGCAGGG + Intronic
1008163528 6:48107008-48107030 GAAAATAGCCATACTGCCCAAGG + Intergenic
1008347663 6:50448560-50448582 GAAAATGGACATACTGGGCATGG - Intergenic
1008594247 6:53025288-53025310 GGGAGTTGCCATAGTGGGTAGGG - Intronic
1009247831 6:61261501-61261523 GAAAATAGCCATACTGCCCAAGG - Intergenic
1009362197 6:62828269-62828291 GAGAATGGCCATACTGCCCAAGG - Intergenic
1009677483 6:66844258-66844280 GAAAATGGCCATAGTGCCCAAGG + Intergenic
1010631145 6:78199815-78199837 GAAAATGGCCATACTGCGCAAGG + Intergenic
1010728481 6:79362524-79362546 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1011869157 6:91870960-91870982 GAAAATAGCCATACTGCCCAAGG - Intergenic
1013683552 6:112552185-112552207 GAAAATAGCCATACTGCCCAAGG - Intergenic
1013889812 6:115012873-115012895 GAAAATAGCCATATTGCCCAAGG + Intergenic
1014642930 6:123935874-123935896 GTGAATAGCCATACTTGCCATGG + Intronic
1017356717 6:153518410-153518432 GAAAATAGCCATACTGCCCAAGG - Intergenic
1017411919 6:154176727-154176749 GAAAATGGCCATAGTGCCCAAGG + Intronic
1018487875 6:164260581-164260603 GAGGATTGTCATAGTGGGAAAGG - Intergenic
1020996635 7:15273705-15273727 GAAAATGGCCATAGTGCCCAAGG - Intronic
1021701668 7:23325480-23325502 GAAAATGGCCATAGTGCCCAAGG + Intronic
1021733628 7:23621162-23621184 GAAAATGGCCATACTGGCCAAGG - Intronic
1022227448 7:28377981-28378003 GATAATAGCCCTAAAGGGCATGG - Intronic
1022483786 7:30761871-30761893 GTTAATGGGCATAGTGGGCACGG - Intronic
1022547183 7:31200360-31200382 GAGAGTAGCCAAGGTGGGGATGG - Intergenic
1023035099 7:36124511-36124533 GAAAATAGCCATACTGCCCAAGG + Intergenic
1023687557 7:42752211-42752233 GAGAAAAGACAAACTGGGCAGGG - Intergenic
1024892771 7:54222658-54222680 GAAAATGGCCATACTGCGCAAGG + Intergenic
1024901146 7:54319729-54319751 GAAAATGGCCATACTGCGCAAGG - Intergenic
1025254602 7:57375076-57375098 GAGAATGGCCACAGTTGGCTTGG - Intergenic
1025312336 7:57963884-57963906 GAAAATGGCCATATTGGCCAAGG - Intergenic
1025479559 7:60965013-60965035 GAAAATGGCCATACTGCGCAAGG + Intergenic
1027429455 7:78095325-78095347 TGGAATATCCATAGTGGGGAAGG - Intronic
1027456976 7:78404226-78404248 GAAAATGGCCATAGTGCCCAAGG + Intronic
1027555847 7:79663992-79664014 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1028312923 7:89361330-89361352 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1028436578 7:90811024-90811046 GAGAATGGCCATACTGCCCAAGG + Intronic
1029946478 7:104538704-104538726 AAGAATAGCAAAAGTGGGTATGG + Intronic
1030331337 7:108274322-108274344 GAAAATAGCCATACTGCCCAAGG - Intronic
1030398150 7:109014127-109014149 GAAAATAGCCATACTGCCCAAGG + Intergenic
1033844388 7:145414554-145414576 GAAAATAGCCATACTGCCCAAGG - Intergenic
1033887940 7:145971108-145971130 GAAAATGGCCATAGTGCCCAAGG + Intergenic
1039207453 8:35173063-35173085 GAGAATGGCCATACTGCCCAAGG - Intergenic
1039404563 8:37301419-37301441 GAGGATAGACATGGTGGGGAAGG + Intergenic
1039664892 8:39514572-39514594 GGCAATAGCCAAAGTGGGTAAGG - Intergenic
1039800459 8:40950180-40950202 TAGAATAGCCATTGTGGACCAGG + Intergenic
1039969708 8:42311169-42311191 GACAATAGCCAGTGTTGGCAAGG - Intronic
1040606711 8:48940675-48940697 GAAAATAGCCATATTGCCCAAGG - Intergenic
1040869329 8:52084043-52084065 GAGAACACCAGTAGTGGGCATGG + Intergenic
1041603392 8:59750713-59750735 GAAAATAGCCATACTGCCCAAGG + Intergenic
1043521910 8:81055540-81055562 GAGAATGGCCATACTGCCCAAGG - Intronic
1043845244 8:85155833-85155855 GAAAATGGCCATACTGCGCAAGG + Intergenic
1043869882 8:85420430-85420452 GAAAATAGCCATACTGCCCAAGG - Intronic
1043910182 8:85854977-85854999 GAAAGCAGCCATAGTGGGTATGG - Intergenic
1044496296 8:92888656-92888678 AAAAATAGCCAAAGGGGGCAAGG - Intronic
1044615810 8:94139601-94139623 AGGAAGAACCATAGTGGGCAGGG + Intronic
1044694172 8:94906210-94906232 GAGAAGAACCAAAGAGGGCAGGG - Intronic
1045143133 8:99309765-99309787 GAAAATGGCCATACTGGCCACGG - Intronic
1045762064 8:105621113-105621135 GAAAATAGCCATACTGCCCAAGG - Intronic
1046198764 8:110894347-110894369 GATAATTGGCATAGTCGGCAGGG - Intergenic
1046232998 8:111382184-111382206 AAGAATAGCCATTCTGGGTAGGG + Intergenic
1046318247 8:112535579-112535601 GAAAATGGCCATAGTGCCCAAGG + Intronic
1046554433 8:115757569-115757591 GAAAATGGCCATAGTGCCCAAGG + Intronic
1046663400 8:116973596-116973618 GAAAATAGCCATACTGCCCAAGG + Intronic
1047525620 8:125631901-125631923 TAAAATAGGCATAGTGGGCAGGG - Intergenic
1049064336 8:140301066-140301088 GAGAAGAGCCATCCTGGGCCAGG - Intronic
1050442419 9:5679423-5679445 GAAAATAGCCATACTGCTCAAGG - Intronic
1051125316 9:13797075-13797097 GAAAATGGCCATAGTGCCCAAGG + Intergenic
1051492240 9:17679215-17679237 GAAAATAGCCATACTGCCCAAGG - Intronic
1051536934 9:18169708-18169730 GAAAATAGCCATACTGCCCAAGG - Intergenic
1052087134 9:24281903-24281925 GAAAATGGCCATAGTGCCCAAGG + Intergenic
1052328610 9:27243920-27243942 GAAAATGGCCATAGTGCCCAAGG + Intergenic
1052857157 9:33414665-33414687 GAGAATGGACTGAGTGGGCAGGG + Intergenic
1053583322 9:39429853-39429875 GAAAATGGCCATAGTGCCCAAGG + Intergenic
1053847513 9:42254713-42254735 GAAAATGGCCATAGTGCCCAAGG + Intergenic
1054104902 9:60988596-60988618 GAAAATGGCCATAGTGCCCAAGG + Intergenic
1055146068 9:72936493-72936515 GAGAAAAGCAATAAAGGGCAAGG - Intronic
1055385795 9:75760811-75760833 GAAAATAGCCATACTGCCCAAGG - Intergenic
1055487211 9:76767857-76767879 GAGAATAGCCATAGTGGGCATGG - Intronic
1055808231 9:80120729-80120751 GAAAATGGCCATAGTGCCCAAGG + Intergenic
1057496239 9:95563700-95563722 GAGAGTAGCCACACTGGGCTGGG - Intergenic
1058253872 9:102736466-102736488 GAAAATAGCCATACTGCCCAAGG - Intergenic
1058555989 9:106167731-106167753 GAAAATAGCCATACTGCCCAAGG - Intergenic
1059044628 9:110853047-110853069 GAGAATTGGCACATTGGGCAAGG - Intergenic
1059833462 9:118124755-118124777 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1061507583 9:131040167-131040189 AAAAATAGAGATAGTGGGCATGG - Intronic
1186761686 X:12729755-12729777 GGGAAGAGCCTTGGTGGGCATGG - Intergenic
1186775427 X:12859885-12859907 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1187573973 X:20534308-20534330 GAGGACAGCAATAGAGGGCAGGG + Intergenic
1188109906 X:26184754-26184776 GAAAATGGCCATAGTGCCCAAGG + Intergenic
1188978236 X:36701781-36701803 GAAAATAGCCATACTGCCCAAGG - Intergenic
1190015034 X:46819515-46819537 GACAATAGCCAGGGTGGCCAAGG + Intergenic
1190326930 X:49212285-49212307 GAGAAGAGCCACATAGGGCAAGG + Exonic
1190544733 X:51513903-51513925 GAAAATGGCCATACTGGCCAAGG - Intergenic
1191003126 X:55682739-55682761 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1191241376 X:58192632-58192654 TAGAATAGCCATGGTCGTCAAGG - Intergenic
1191567647 X:62559997-62560019 GAAAATAGCCTTAGTGCCCAAGG + Intergenic
1191704530 X:64080445-64080467 GAGAATGGCCATACTGTCCAAGG - Intergenic
1192260155 X:69501265-69501287 CAGAATAGCCAAGGTGGGGAGGG - Intergenic
1192389024 X:70705379-70705401 GAAAATAGCCATACTGCCCAAGG - Intronic
1192431332 X:71114147-71114169 TAGAATAGCCAAAATGGGCTGGG + Intergenic
1192475955 X:71443244-71443266 GAAAATGGCCATAGTGCCCAAGG - Intronic
1192909763 X:75590912-75590934 GAGAATGGCCATACTGCCCAAGG + Intergenic
1193259695 X:79391079-79391101 GAAAATAGCCATACTGCCCAAGG + Intergenic
1193661453 X:84263418-84263440 GAAAATAGCCATACTGCCCAAGG - Intergenic
1193965934 X:87986611-87986633 GAAAATAGCCATACTGCCCAAGG - Intergenic
1194461514 X:94175475-94175497 GAGAATAGCCAAAGTGTTTAAGG + Intergenic
1195409050 X:104549176-104549198 GAAAATGGCCATAGTGCCCAAGG + Intergenic
1195410086 X:104560681-104560703 GAAAATAGCCATAGTGCCCAAGG - Intergenic
1195817870 X:108908192-108908214 GAAAATGGCCATAGTGCCCAAGG + Intergenic
1196167085 X:112547390-112547412 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1197294315 X:124698933-124698955 TAGAACAGCCAGAGTGGGGAGGG - Intronic
1197921696 X:131601504-131601526 CAGAATAGAGATAGTGTGCAGGG + Intergenic
1197960026 X:131994052-131994074 GAAAATGGCCATACTGGCCAAGG + Intergenic
1198129121 X:133676349-133676371 GTGCATGGCCATGGTGGGCATGG + Intronic
1199148399 X:144398085-144398107 CAGAACAGCCATAGTGGGGCTGG + Intergenic
1199296051 X:146159911-146159933 GAGAATAGCCACAATAGGCCAGG - Intergenic
1199600872 X:149540442-149540464 GAGAGAAACCATTGTGGGCAGGG - Intronic
1199662657 X:150067690-150067712 GAAAATGGCCATAGTGTCCAAGG - Intergenic
1200371000 X:155724368-155724390 GAAAATAGCCATACTGCCCAAGG - Intergenic
1200819867 Y:7571637-7571659 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1200872373 Y:8116419-8116441 GAAAATAGCCATACTGCCCAAGG + Intergenic
1201450570 Y:14108273-14108295 TATAATAGCCATTGTAGGCAAGG - Intergenic
1201529148 Y:14972729-14972751 GAAAATGGCCATAGTGCCCAAGG - Intergenic
1201561109 Y:15317884-15317906 GAAAATAGCCATAATGCCCAAGG - Intergenic
1201992165 Y:20039340-20039362 GAGAATGGCCATACTGCCCAAGG + Intergenic
1202080155 Y:21075832-21075854 CACAATCACCATAGTGGGCATGG - Intergenic
1202333013 Y:23774586-23774608 GAAAATGGCCATATTGGCCAAGG - Intergenic
1202537756 Y:25895477-25895499 GAAAATGGCCATATTGGCCAAGG + Intergenic