ID: 1055487316 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:76768492-76768514 |
| Sequence | GACTTGATAGTTGTTGAAAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1055487316_1055487320 | 9 | Left | 1055487316 | 9:76768492-76768514 | CCCATTTCAACAACTATCAAGTC | No data | ||
| Right | 1055487320 | 9:76768524-76768546 | CCGCACCTAGAACGTTCTCTGGG | No data | ||||
| 1055487316_1055487323 | 24 | Left | 1055487316 | 9:76768492-76768514 | CCCATTTCAACAACTATCAAGTC | No data | ||
| Right | 1055487323 | 9:76768539-76768561 | TCTCTGGGTCTCTTATCTTTGGG | No data | ||||
| 1055487316_1055487322 | 23 | Left | 1055487316 | 9:76768492-76768514 | CCCATTTCAACAACTATCAAGTC | No data | ||
| Right | 1055487322 | 9:76768538-76768560 | TTCTCTGGGTCTCTTATCTTTGG | No data | ||||
| 1055487316_1055487318 | 8 | Left | 1055487316 | 9:76768492-76768514 | CCCATTTCAACAACTATCAAGTC | No data | ||
| Right | 1055487318 | 9:76768523-76768545 | GCCGCACCTAGAACGTTCTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1055487316 | Original CRISPR | GACTTGATAGTTGTTGAAAT GGG (reversed) | Intronic | ||