ID: 1055487316

View in Genome Browser
Species Human (GRCh38)
Location 9:76768492-76768514
Sequence GACTTGATAGTTGTTGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055487316_1055487320 9 Left 1055487316 9:76768492-76768514 CCCATTTCAACAACTATCAAGTC No data
Right 1055487320 9:76768524-76768546 CCGCACCTAGAACGTTCTCTGGG No data
1055487316_1055487323 24 Left 1055487316 9:76768492-76768514 CCCATTTCAACAACTATCAAGTC No data
Right 1055487323 9:76768539-76768561 TCTCTGGGTCTCTTATCTTTGGG No data
1055487316_1055487322 23 Left 1055487316 9:76768492-76768514 CCCATTTCAACAACTATCAAGTC No data
Right 1055487322 9:76768538-76768560 TTCTCTGGGTCTCTTATCTTTGG No data
1055487316_1055487318 8 Left 1055487316 9:76768492-76768514 CCCATTTCAACAACTATCAAGTC No data
Right 1055487318 9:76768523-76768545 GCCGCACCTAGAACGTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055487316 Original CRISPR GACTTGATAGTTGTTGAAAT GGG (reversed) Intronic