ID: 1055490047

View in Genome Browser
Species Human (GRCh38)
Location 9:76795522-76795544
Sequence GCTATTAGTAACTCAAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055490047 Original CRISPR GCTATTAGTAACTCAAAATC AGG (reversed) Intronic
902147793 1:14418202-14418224 GATATTAGGAGCTCAAATTCAGG + Intergenic
902938197 1:19779973-19779995 GCTCTAAGGAACTCACAATCTGG - Intronic
903209079 1:21805799-21805821 GAAATTATTAACACAAAATCAGG + Intergenic
908271870 1:62430223-62430245 GCTATCAGTGAGTCAAAGTCTGG + Intergenic
908441252 1:64156922-64156944 GCTGCTAGTAAGTCAAAAGCTGG - Intronic
910764074 1:90763109-90763131 ACTATTATTAACTCTAAAACTGG + Intergenic
910991917 1:93065295-93065317 GTTATTAGTAACTCATGAACTGG + Intergenic
917690717 1:177465655-177465677 TCTATAAGTTACTCAAACTCGGG - Intergenic
921178280 1:212611727-212611749 GCTACTAGGAAATAAAAATCTGG + Intronic
921591776 1:217012507-217012529 GCTATCAGTAACTCGAAACAAGG - Intronic
922036937 1:221858103-221858125 GCACTTAGTACCTCCAAATCAGG + Intergenic
1063402293 10:5757929-5757951 GCTCCTAGTAACACAAATTCAGG + Intronic
1063848463 10:10159235-10159257 GCTATTGGTTACTCATAATTGGG - Intergenic
1064344491 10:14519082-14519104 GTAATTAGTAATACAAAATCTGG - Exonic
1064956758 10:20919762-20919784 ACCATTCCTAACTCAAAATCCGG + Intronic
1068345104 10:55766428-55766450 GTTCTTAATAACTCAAAAACGGG + Intergenic
1070383179 10:75900181-75900203 GCAATTAGTTATTCAAAATACGG - Intronic
1070861456 10:79668488-79668510 GTTCTTAATAACTCAAAAACAGG - Intergenic
1070875790 10:79807115-79807137 GTTCTTAATAACTCAAAAACAGG + Intergenic
1071642721 10:87329241-87329263 GTTCTTAATAACTCAAAAACAGG + Intergenic
1074486571 10:113889164-113889186 TCTATAAATGACTCAAAATCAGG - Intronic
1074895330 10:117772500-117772522 GCTATTACACACTCAAAATGTGG + Intergenic
1075271179 10:121052958-121052980 GCAATAACTAACTCAAAATTTGG + Intergenic
1085860537 11:80228510-80228532 GATATCAGTAATTCAAAATATGG + Intergenic
1086459684 11:86994391-86994413 GGTCTTAGAAACTTAAAATCAGG + Intergenic
1092857472 12:12688206-12688228 ACTATTAGTAACGCTAAATTTGG - Intronic
1094660406 12:32465180-32465202 GCTATTAGTAAATTAAATTTTGG - Intronic
1095234122 12:39776870-39776892 GGTTTTATTAATTCAAAATCAGG - Intronic
1097846618 12:64373116-64373138 GTTATGAGTTACTCAAAAACAGG + Intronic
1098171843 12:67754949-67754971 TCTAGTAGTAACTTGAAATCGGG + Intergenic
1098406323 12:70130461-70130483 GAGATTAACAACTCAAAATCTGG - Intergenic
1102445420 12:112998580-112998602 GCTATTACAAGTTCAAAATCAGG + Intronic
1102826225 12:115949926-115949948 CCTCTCAGTAACTCAAACTCAGG + Intergenic
1107005779 13:35609721-35609743 GCTATTGGTAACGCAAGATAAGG - Intronic
1107628513 13:42317041-42317063 GCTATTAAAAATACAAAATCCGG - Intronic
1108064126 13:46560269-46560291 GCTATTATTAACTCCATATAAGG + Intronic
1109492764 13:63125427-63125449 AATATTAGTAACTCAAAAATTGG - Intergenic
1109770609 13:66966874-66966896 GTTATTAGTAACTTTGAATCAGG + Intronic
1111379339 13:87426063-87426085 GGTATGAGTAAATCAAAAACTGG + Intergenic
1111518915 13:89373703-89373725 GCTCTAAGTAACTCAAAAGAAGG + Intergenic
1119499021 14:75107045-75107067 GCTATGAATAACACAAAATTAGG - Intronic
1124085870 15:26549910-26549932 ACTTTTATTTACTCAAAATCTGG + Intronic
1124390426 15:29250712-29250734 GCTATGAGTATAGCAAAATCTGG - Intronic
1131929953 15:97430828-97430850 CCTTTTAGTAACTCAAAATGTGG - Intergenic
1134030817 16:10990928-10990950 GCTTCAGGTAACTCAAAATCAGG - Intronic
1134750385 16:16620205-16620227 GCTTTTAGCTACTCAAAATGTGG - Intergenic
1134995071 16:18733387-18733409 GCTTTTAGCTACTCAAAATGTGG + Intergenic
1137029585 16:35509096-35509118 TTTTTTAGTAACTTAAAATCTGG - Intergenic
1140577663 16:76190692-76190714 GCTATTAAGAACTTAAAATGTGG - Intergenic
1149271654 17:54985060-54985082 GCCATTTTTAACTGAAAATCGGG + Intronic
1149434044 17:56618365-56618387 GCTCTTAGCAACTCAGGATCAGG + Intergenic
1153559113 18:6352131-6352153 GCTAGTAATTACTCAAAATGTGG + Intronic
1156083712 18:33373913-33373935 GTTATAAGCAACTCTAAATCTGG + Intronic
1157279876 18:46339768-46339790 ACTATTAGTTACTCAAATTTAGG + Intronic
1158061173 18:53344737-53344759 GCTATTAATAACTCAAATTTAGG - Intronic
1159748097 18:72264350-72264372 TCTGTAAGTAACTGAAAATCTGG - Intergenic
1162425321 19:10591712-10591734 ACTATTAGTAACACTAACTCTGG + Intergenic
1164924021 19:32112369-32112391 GAGATTAGTAAATAAAAATCAGG + Intergenic
926489770 2:13510647-13510669 ACTGTTAGTAATTCGAAATCTGG + Intergenic
929001833 2:37354454-37354476 GCTATTATTATCTCAATATTAGG + Intronic
934021164 2:87954512-87954534 GCTATTTTTAACTAAAAATTTGG - Intergenic
934953515 2:98596168-98596190 AATATTAGTCATTCAAAATCTGG - Intergenic
937871551 2:126789658-126789680 GCTTTTAGAAACCCAAAAGCTGG + Intergenic
942433575 2:175944872-175944894 GCTATTAGTAAATAAAAGTTAGG + Intronic
942515203 2:176745431-176745453 GGTATTAGTCAGTCAAAATCAGG - Intergenic
947504450 2:230696387-230696409 GCTTTAAGAAACTCAAAAACTGG - Intergenic
948561998 2:238860497-238860519 TCTATCAGTGTCTCAAAATCTGG - Intronic
1170468682 20:16646766-16646788 CATATTGGTATCTCAAAATCAGG - Intergenic
1172264923 20:33602853-33602875 GCCATTATTAACTAATAATCAGG + Intronic
1172286872 20:33746849-33746871 GCTAGTGGCAACTCTAAATCAGG - Intronic
1173126779 20:40343950-40343972 GATATCAGTAACACAAAATGTGG + Intergenic
1173363487 20:42365234-42365256 GCTATTAAACACTCAAAATGTGG - Intronic
1174844611 20:53931120-53931142 GCTATTAGTAAATGAAAAAGTGG - Intergenic
1180021430 21:45130455-45130477 GCATTTAGTAACACAGAATCAGG - Intronic
951475705 3:23103439-23103461 GATATTAGTAACATAAACTCTGG + Intergenic
953526512 3:43694377-43694399 TTTTTTAGTAACTCACAATCAGG - Intronic
958715929 3:97780067-97780089 GATTTTAGAAACTGAAAATCTGG + Intronic
959745641 3:109773838-109773860 TCTTTGAGTAGCTCAAAATCTGG + Intergenic
962303647 3:134266766-134266788 CCTATTTGTAACTCAAAAACCGG + Intergenic
962700360 3:137992541-137992563 GCTATTAGTCACTCAAACTGGGG + Intergenic
968043676 3:195611178-195611200 GCTTTCAGTAACTCCAAATTAGG - Intergenic
970738837 4:19208625-19208647 GATATTATTAACTTAAAATGAGG - Intergenic
971307827 4:25498986-25499008 GCTATTATTTTTTCAAAATCAGG + Intergenic
971999825 4:34017173-34017195 GCTATTAGTCATTAAAAGTCGGG - Intergenic
972490841 4:39585658-39585680 GATATTAGCAAATCAAAGTCAGG - Intronic
978724537 4:111955089-111955111 GCTATTATTAACCTAAACTCAGG - Intergenic
979058712 4:116027644-116027666 TCTATTGGTAACACAAATTCAGG + Intergenic
980609559 4:135140218-135140240 GCAGTTAGTAATTCAAAATATGG + Intergenic
980725628 4:136756909-136756931 ACTATTAGTATCTCACACTCTGG - Intergenic
993459435 5:88165061-88165083 GCTACATGTAACTGAAAATCAGG + Intergenic
993914576 5:93727445-93727467 GTTATTTGTAACTCAACTTCAGG - Intronic
994456808 5:100019767-100019789 CCTATGAGTAACTCAAGATATGG - Intergenic
998660179 5:144227960-144227982 AATATTAGGAATTCAAAATCTGG + Intronic
999057622 5:148596883-148596905 GCTATTAGCTACACAAAGTCAGG - Intronic
1002590053 5:180284414-180284436 GCTATGAGCAACTCAAAACTGGG + Intronic
1012166966 6:95968293-95968315 GATATTAATAACTTAAAATATGG + Intergenic
1012385976 6:98683515-98683537 ACTATTAGTAACAGAAAACCTGG + Intergenic
1015651433 6:135465437-135465459 GGTATTTGTAACTCAAAAAAGGG + Intronic
1016977075 6:149819876-149819898 GCTGTTACTAATTCAAAGTCTGG + Exonic
1022657453 7:32332601-32332623 ACTATTCATAAGTCAAAATCTGG + Intergenic
1023347607 7:39287416-39287438 GCTAATAGTAACTAGAAATCTGG - Intronic
1024012030 7:45276137-45276159 GGTTTTAGTTACTAAAAATCTGG + Intergenic
1027906349 7:84187873-84187895 GCCTTTAGAAACTCAGAATCTGG + Intronic
1030726683 7:112934573-112934595 GCTATTATTAACTTTAGATCAGG + Intronic
1031151499 7:118059435-118059457 GATTTTAGTAACCCAAAATGTGG - Intergenic
1032327241 7:130941336-130941358 GTTATTAGACACTCAATATCCGG - Intergenic
1032868880 7:135958747-135958769 CCCATTAGTGACTCAAATTCAGG - Intronic
1034537308 7:151733529-151733551 CCTATTATTAACTAAAAATCTGG - Intronic
1034995752 7:155576350-155576372 TCTGTCAGTAGCTCAAAATCAGG - Intergenic
1040839513 8:51770374-51770396 GCTAATAGTAAAGCAAAAACGGG + Intronic
1041085922 8:54256179-54256201 GCTATTAGAAATTCAATATTGGG - Intergenic
1041114135 8:54517845-54517867 GCTATTCCTATCTCAAAAACTGG + Intergenic
1041960811 8:63613598-63613620 ACTATGAGTTCCTCAAAATCAGG - Intergenic
1043126414 8:76401841-76401863 CCTATTAGTAAATCATGATCTGG - Intergenic
1043756810 8:84013804-84013826 GGTAATAGTAACTCAACATAAGG + Intergenic
1046179590 8:110626687-110626709 GTAATTATTAACTCCAAATCTGG + Intergenic
1047876961 8:129149210-129149232 ACTATTACTAACCGAAAATCTGG + Intergenic
1048720162 8:137314361-137314383 GATATTTTCAACTCAAAATCAGG + Intergenic
1049132675 8:140862001-140862023 CCTATTAGTAAAAGAAAATCTGG + Intronic
1051880252 9:21832741-21832763 CCTAATAGGAACTCAAAAACTGG - Intronic
1052422102 9:28255756-28255778 GTTATTATTACCTCAAGATCAGG - Intronic
1055490047 9:76795522-76795544 GCTATTAGTAACTCAAAATCAGG - Intronic
1056141303 9:83682980-83683002 CCTAATAGTAACTCTACATCTGG - Exonic
1056959220 9:91106892-91106914 GCTTTCTGTAACTCAAATTCAGG + Intergenic
1186098887 X:6133662-6133684 GCTTCCAGTGACTCAAAATCTGG - Intronic
1186154136 X:6708105-6708127 ACTTTTAGTAACTCAAAACAAGG + Intergenic
1187877753 X:23817998-23818020 GCTAAAAGCAACTAAAAATCTGG - Intergenic
1188250126 X:27882766-27882788 GCTATTGAGCACTCAAAATCTGG - Intergenic
1189627721 X:42917364-42917386 TTTATTAGTTACTTAAAATCTGG + Intergenic
1193849935 X:86524493-86524515 AATATTAGTAATTCAAACTCTGG - Intronic
1197842233 X:130761055-130761077 ACTATTAGTAAGCCAAATTCAGG - Intronic
1199123361 X:144084617-144084639 GCTATTTTTAACTAAAAATTTGG + Intergenic
1201465479 Y:14275728-14275750 GTCATTACTAACTCAAAAACAGG + Intergenic