ID: 1055492079

View in Genome Browser
Species Human (GRCh38)
Location 9:76815547-76815569
Sequence TAGGGGACTAGGGAGGTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 292}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055492079_1055492086 -1 Left 1055492079 9:76815547-76815569 CCAATCACCTCCCTAGTCCCCTA 0: 1
1: 0
2: 1
3: 25
4: 292
Right 1055492086 9:76815569-76815591 ACCTCTTAGTACTACTTCATTGG No data
1055492079_1055492088 0 Left 1055492079 9:76815547-76815569 CCAATCACCTCCCTAGTCCCCTA 0: 1
1: 0
2: 1
3: 25
4: 292
Right 1055492088 9:76815570-76815592 CCTCTTAGTACTACTTCATTGGG No data
1055492079_1055492090 27 Left 1055492079 9:76815547-76815569 CCAATCACCTCCCTAGTCCCCTA 0: 1
1: 0
2: 1
3: 25
4: 292
Right 1055492090 9:76815597-76815619 AAATTTCAACATATACATTTTGG No data
1055492079_1055492091 30 Left 1055492079 9:76815547-76815569 CCAATCACCTCCCTAGTCCCCTA 0: 1
1: 0
2: 1
3: 25
4: 292
Right 1055492091 9:76815600-76815622 TTTCAACATATACATTTTGGAGG No data
1055492079_1055492089 1 Left 1055492079 9:76815547-76815569 CCAATCACCTCCCTAGTCCCCTA 0: 1
1: 0
2: 1
3: 25
4: 292
Right 1055492089 9:76815571-76815593 CTCTTAGTACTACTTCATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055492079 Original CRISPR TAGGGGACTAGGGAGGTGAT TGG (reversed) Intronic
900211795 1:1459803-1459825 TAGGGGACTTGGGAGGGACTAGG - Intronic
900224606 1:1527103-1527125 TAGGGGACTTGGGAGGGACTAGG - Intronic
900840840 1:5047332-5047354 TAGGGGGCTTCCGAGGTGATTGG - Intergenic
901531931 1:9859176-9859198 CAGGGGACTAGTGAGGTGTCTGG - Intronic
902571800 1:17351960-17351982 GAGGCGGCCAGGGAGGTGATGGG + Intronic
902571816 1:17352014-17352036 GAGGCGGCCAGGGAGGTGATGGG + Intronic
902918333 1:19652099-19652121 CAGGGGGCCAGGGAGGTGACTGG - Intronic
903398032 1:23017588-23017610 TAGGGAAGTAGGGAGGTTGTTGG - Intergenic
903482181 1:23661792-23661814 TGGGGTATTTGGGAGGTGATTGG - Intergenic
903653320 1:24933944-24933966 TAGGGCACTGGGCAGGAGATAGG - Intronic
903753867 1:25647282-25647304 CAGGGGACTAGGGTGGTGAAAGG + Intronic
904035476 1:27556427-27556449 TGGAGGAAAAGGGAGGTGATGGG - Intronic
904311512 1:29632588-29632610 TAGGGGACTGAGGAGATGAGGGG - Intergenic
905234415 1:36536082-36536104 AAGGTGAGTAGGGAGGTGACAGG + Intergenic
905246047 1:36614621-36614643 TGGGGGAGGAGGGAGGTGACTGG + Intergenic
905441753 1:38000447-38000469 TTTGGGACTAGGGAGCTGAAAGG + Intronic
908131103 1:61076437-61076459 TAGGGGAGTAGGAAGGGGAGGGG + Intronic
908395280 1:63719743-63719765 TGGGGGCATGGGGAGGTGATGGG + Intergenic
909434080 1:75619968-75619990 TGGGGGACTAGGGGAGGGATAGG - Intergenic
909776640 1:79491792-79491814 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
911410905 1:97505001-97505023 CAGGGGACTTGGGTGGTCATTGG + Intronic
911570440 1:99512104-99512126 TAGGGGGCTTCTGAGGTGATTGG - Intergenic
919621743 1:199871420-199871442 GAGGGAACTGGGGAGGAGATAGG - Intergenic
919849774 1:201664840-201664862 CAGGGGAAAAGGGAGGAGATGGG - Intronic
920840999 1:209553680-209553702 TTGGGGTTTAGGGAGGTCATGGG - Intergenic
921070738 1:211655805-211655827 TAGGGGGCTGGGGAGGGGAGCGG - Intergenic
922660838 1:227429163-227429185 TCCTGGACTAGGGAGGGGATGGG - Intergenic
923283012 1:232462858-232462880 TAGGGGAGGTGGCAGGTGATTGG - Intronic
1063963692 10:11328270-11328292 AAGGAGACTAGGGAAGTGCTGGG - Intronic
1064361242 10:14666746-14666768 CAGGGAACTTGGGAGGAGATGGG + Intronic
1065443071 10:25771980-25772002 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
1066431787 10:35358948-35358970 CAGGGAAGTAGGGAGGTGAGTGG + Intronic
1067459081 10:46444261-46444283 CAGGGGACCAGGGAGGTGCTAGG - Intergenic
1067628116 10:47940369-47940391 CAGGGGACCAGGGAGGTGCTAGG + Intergenic
1068179609 10:53502262-53502284 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
1070180771 10:74011416-74011438 TAGGAGAGTAGGGAGGAGAGGGG - Intronic
1070702798 10:78615771-78615793 TAGGGGACTATGGTGATGGTGGG - Intergenic
1070817134 10:79331695-79331717 GAGGGGAATAGGGAGGAGGTGGG - Intergenic
1072318169 10:94223355-94223377 TAGGGGAGAGGTGAGGTGATTGG + Intronic
1072580311 10:96734697-96734719 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
1074272519 10:111968790-111968812 CCGGGGACTAGGGAGTTGAGGGG + Intergenic
1074542535 10:114377126-114377148 TCTGGGACTAGGAAGGAGATGGG - Intronic
1075288224 10:121205285-121205307 AAGGGGAATACGGAGGTTATTGG + Intergenic
1076010563 10:126984942-126984964 TAGGGGAGTGGGGAGATGATGGG - Intronic
1076500599 10:130933317-130933339 TGGGAGACCAGGGAGGTGTTGGG + Intergenic
1077351886 11:2096901-2096923 AAGGGGTCTAGGGAGGAGCTGGG - Intergenic
1077634758 11:3834809-3834831 TAGGCGAGTATGGAGGTGATGGG + Intronic
1077644589 11:3912183-3912205 TAGGGGAGAAGGGAGGGGAGGGG - Intronic
1078429706 11:11279738-11279760 GAAGGGACTGGGAAGGTGATGGG + Intronic
1078450138 11:11434730-11434752 GAAGGGAATAGGGAGGTGAGGGG + Intronic
1078460513 11:11511666-11511688 TAGGGCCTTTGGGAGGTGATTGG + Intronic
1078697444 11:13648620-13648642 GAGGGGCCTGGTGAGGTGATTGG + Intergenic
1081614553 11:44582954-44582976 TTGGGGGATAGGGAGGGGATTGG - Intronic
1081722011 11:45296708-45296730 TGGGGGATTAAGGAGGAGATGGG - Intergenic
1083373589 11:62201842-62201864 TTTGGGAATAGGGAGGAGATGGG + Intergenic
1084366033 11:68699849-68699871 CCAGGGGCTAGGGAGGTGATGGG + Intergenic
1085032874 11:73283355-73283377 CAGGGGATTAGGGAGGTGACTGG - Intronic
1086217884 11:84405736-84405758 AAGGGGACTAGGAATGTGGTGGG + Intronic
1089418871 11:118316041-118316063 TAGGGGATTAGGGGGTTGGTAGG - Exonic
1090866111 11:130702247-130702269 TAGGGGAACAGGGAGGTTGTGGG - Intronic
1090871911 11:130756747-130756769 TAGGGGGCTTCTGAGGTGATCGG + Intergenic
1091615673 12:2049777-2049799 TTGGGGATTTGGGAGGTGGTGGG - Intronic
1092264106 12:6968061-6968083 GAGGGGACTGGGGAGCTGAAAGG + Intronic
1092850560 12:12622523-12622545 TGGGGGATGAGGGAGGGGATAGG + Intronic
1093321938 12:17723502-17723524 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
1094549250 12:31435125-31435147 TACGGGAATAGGGAAGTGAGGGG - Intronic
1096174333 12:49502564-49502586 TAGGGGACTAGGGAGGCTGAGGG - Intronic
1097035282 12:56119767-56119789 TAGGGGAGTAGGAAGGGGGTGGG + Intronic
1098451526 12:70623602-70623624 TAGTGCACTATGGAGTTGATGGG - Intronic
1098841926 12:75487629-75487651 GACGTGACTAGGGAGATGATGGG - Intronic
1100561410 12:95751661-95751683 TAGGGGGCTTCCGAGGTGATCGG - Intronic
1101913833 12:108880799-108880821 TAGGGGACAAGGGAGGTCCTAGG + Intronic
1102012699 12:109628470-109628492 GAGGGGGCCAGGGAGGTGATGGG + Intergenic
1102148474 12:110672088-110672110 TTGGGGACAAAGGAGGGGATTGG + Intronic
1102536182 12:113583230-113583252 TAGGGGAAAAGGGAGATGAATGG - Intergenic
1102569108 12:113816591-113816613 TAAGGAGCTAGGGAGGTGTTCGG + Intergenic
1102599970 12:114022247-114022269 TAGGGGACTTCCGAGGTGATCGG - Intergenic
1104094657 12:125546089-125546111 GTGGGAACTTGGGAGGTGATGGG - Intronic
1106008019 13:25789516-25789538 TAGGTAACTAGGGAGGTGAAAGG + Intronic
1106156817 13:27166838-27166860 TAGGGTACTAGGGCGTTGACAGG - Intronic
1107224079 13:38026100-38026122 TAGGGGGTTTGGGAGGTGGTAGG - Intergenic
1107748866 13:43542983-43543005 TAGGGCCTTTGGGAGGTGATTGG - Intronic
1108056178 13:46487619-46487641 TAGGGTATTTGGGAGGTAATTGG - Intergenic
1109065005 13:57675725-57675747 TATGAGACTAGGGAGGTGGCTGG + Intronic
1109709616 13:66144564-66144586 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
1111878016 13:93920725-93920747 TGGGGGACTAGTGAGGGAATAGG - Intronic
1113684367 13:112271985-112272007 TAGGAGACGAGGGATGTGCTGGG - Intergenic
1113867365 13:113535838-113535860 TGGGGGTCTGGGGAGGGGATGGG + Intronic
1114049865 14:18913921-18913943 TGGGGCCCTAGGGAGGTGACAGG - Intergenic
1114112692 14:19488009-19488031 TGGGGCCCTAGGGAGGTGACAGG + Intergenic
1114653551 14:24302216-24302238 TAGGGGACTAGGGACAAGAAGGG - Exonic
1115077444 14:29408731-29408753 TAGGGCGGGAGGGAGGTGATTGG + Intergenic
1115082157 14:29467853-29467875 TGGGAAAATAGGGAGGTGATGGG + Intergenic
1116070308 14:40035458-40035480 TAGGGCCTTTGGGAGGTGATTGG - Intergenic
1116598635 14:46888485-46888507 TAGGGTACTTGGGAGGTTTTAGG - Intronic
1119062451 14:71489212-71489234 TTGGGGCCTAGGGATCTGATAGG + Intronic
1120128551 14:80777215-80777237 GAGGTGATTTGGGAGGTGATTGG + Intronic
1120876717 14:89382085-89382107 GAGGGGAATAGGGAGGAGAATGG - Intronic
1121007724 14:90500953-90500975 TGGGGGACTGGGGAGGAGAGAGG + Intergenic
1121476818 14:94216562-94216584 TAGGGGACAAGGCAGGAGATTGG + Intronic
1122006482 14:98708499-98708521 TCGGGGGCTGGGGAGGAGATGGG - Intergenic
1122284394 14:100642161-100642183 AAGGGGACTAGGGAGGAGGGAGG + Intergenic
1122317319 14:100833821-100833843 TAGGGGATAAGGGAGGTAGTTGG + Intergenic
1122852498 14:104544282-104544304 AAGGGGTCTGGGCAGGTGATGGG + Intronic
1123049197 14:105532486-105532508 GAGGGGACAAGGGAGCTGACTGG - Intergenic
1123762503 15:23443748-23443770 CAGGAGACTGGGGAGGTGATTGG + Intronic
1125745149 15:41992725-41992747 TGGGGGACGAGGTAGGTGCTCGG - Exonic
1125884485 15:43218523-43218545 CAGAGGACTAAGCAGGTGATGGG - Intronic
1126243977 15:46481809-46481831 TGGGGGCCTTGGAAGGTGATTGG + Intergenic
1126778436 15:52119033-52119055 AAGGGGAATGGGGAGGAGATGGG + Exonic
1132263061 15:100442772-100442794 TAGGGGGCTTCCGAGGTGATCGG - Intronic
1132340465 15:101075022-101075044 TAGGGGGCTTCCGAGGTGATCGG - Intronic
1135643118 16:24138188-24138210 AAGGGGACTATGGAGCTGAGTGG - Intronic
1136371142 16:29836863-29836885 TGGGGGCCCAGGGTGGTGATGGG - Exonic
1136422950 16:30148032-30148054 TTGGGGAGTAGGGAGGGGACAGG - Intergenic
1137391286 16:48083449-48083471 TTGGGGATTTGGGAGGTGAAGGG + Exonic
1138585256 16:57964893-57964915 GAGGGGAAGAGGGAGGTGAGAGG + Intronic
1138840805 16:60502767-60502789 TAAGGGACAAAGGAGGTGCTGGG + Intergenic
1141665596 16:85463655-85463677 GATGGGGCCAGGGAGGTGATCGG - Intergenic
1143002780 17:3805568-3805590 TGGGGGACTGCGGGGGTGATGGG + Intergenic
1144476914 17:15596462-15596484 AAGGGCACTGGGGAGGAGATGGG - Intronic
1144921327 17:18766892-18766914 AAGGGCACTGGGGAGGAGATGGG + Intronic
1145827609 17:27888995-27889017 AAAGGGACTAGGGAGGGGCTGGG - Intronic
1146472834 17:33138395-33138417 TTGAGGACTAGAGAGGTGAAAGG + Intronic
1146597947 17:34185760-34185782 TAGGGGGCTTCCGAGGTGATTGG - Intergenic
1147442777 17:40457588-40457610 CAGGGGAGTAGGGAGGTGTGGGG - Exonic
1148188216 17:45660051-45660073 AAGGAGACTTGGGATGTGATGGG - Intergenic
1148866315 17:50630634-50630656 GTGGGGACTAGGGTGGAGATAGG - Intergenic
1151384666 17:73747715-73747737 AAGGGGACTGGGGAGGGGACCGG + Intergenic
1151518459 17:74612441-74612463 CAGGGGACTGGGGAGGAGAAAGG + Exonic
1156254096 18:35378408-35378430 TAGGGGACTAGGGAGAGGTTTGG + Intergenic
1159080364 18:63729470-63729492 CAGGGGACTAGGGAGAGGAAGGG + Intergenic
1159096573 18:63908690-63908712 TAGGTGAATAGAGAGGTGCTGGG + Intronic
1160723423 19:607346-607368 TATGGGACTTGGGATGTGTTTGG + Intronic
1161022366 19:2016077-2016099 GAGGGGAGAAGGGAGGTGAATGG + Intronic
1161345951 19:3768804-3768826 AGGGGGAGGAGGGAGGTGATGGG - Intergenic
1161853308 19:6750138-6750160 TCGGGGACAGGGGAGGTGTTCGG + Intronic
1162821919 19:13228316-13228338 TAGGGGCTTTGGGAGGTGAGGGG + Intronic
1163487338 19:17595911-17595933 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
1166930357 19:46298211-46298233 TAGGGGACAGGGGAGAGGATGGG - Intronic
1167523111 19:49968851-49968873 TTGGGGAATCGGGAGGTGCTGGG + Intergenic
1168203398 19:54833344-54833366 TATGGGACTAGAGTGGAGATAGG + Intronic
1168203457 19:54833575-54833597 TATGGGACTAGAGTGGAGATAGG + Intronic
1168303744 19:55422358-55422380 TAGGGGTAAAGGGATGTGATAGG + Intergenic
925435533 2:3834341-3834363 TAGGGGACAAGGGAGTGGATGGG - Intronic
925896596 2:8477006-8477028 TAGGGCACTAAGGAAGTGAGAGG - Intergenic
927881807 2:26694328-26694350 AAGGGGACTAGGGAGAGGAGAGG - Intronic
928269987 2:29847271-29847293 TCGGGGAATAGGGTGGTGGTAGG + Intronic
929601265 2:43206218-43206240 TAGGGGCCAAGGGAAGTGAAGGG + Intergenic
929871574 2:45763513-45763535 TTGGAGACTAGGGAGGGGGTGGG - Intronic
930157276 2:48118608-48118630 CAGGGGGCTAGTGAGGTGAGAGG - Intergenic
931042664 2:58316179-58316201 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
931625828 2:64255015-64255037 TAGGGGTCTTCCGAGGTGATCGG - Intergenic
931845937 2:66203903-66203925 CAGAGGACTGGGGAGGTGAGAGG + Intergenic
932367598 2:71162911-71162933 TAGGGGGCTTCCGAGGTGATTGG + Intergenic
933577479 2:84086030-84086052 CAGGGGACTAGTGAAGTGAGAGG - Intergenic
934660919 2:96143369-96143391 CTGGGGACTTGGGAAGTGATGGG - Exonic
935308375 2:101759587-101759609 AAGGGGAATGGGGAGGTGAATGG - Intronic
935562774 2:104575938-104575960 TAGGGGAATGGGAAGGTGAGAGG - Intergenic
935572177 2:104673424-104673446 GAGGGGGGTAGGGAGGTGGTCGG - Intergenic
938030165 2:127985633-127985655 AAGGGGAGTAGGGAAGTGCTGGG + Intronic
938939750 2:136159433-136159455 TAGGGGGATAGGGAGGAGGTGGG + Intergenic
939405939 2:141756092-141756114 TAGGGAATTTGGGAGGTGATAGG - Intronic
939529324 2:143337267-143337289 TAGGAGGCTAGGGAGGTGGGAGG + Intronic
940669764 2:156652435-156652457 TAGGGGATTAGGGAGAGGAGAGG - Intergenic
944308954 2:198210868-198210890 TGGGGCATTTGGGAGGTGATTGG - Intronic
946817192 2:223591303-223591325 TGGGGGAGAAGGGAGGTGACTGG - Intergenic
946886547 2:224227773-224227795 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
946893321 2:224299158-224299180 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
947535357 2:230936993-230937015 TAGGAGACTAGGGAGGTAAGAGG - Intronic
948757316 2:240167212-240167234 TTGGGGACTTGGGAGGTTCTCGG + Intergenic
948889478 2:240900043-240900065 TGGGGGAGGAAGGAGGTGATGGG + Intergenic
1168838676 20:894898-894920 TGGGGGACCAGTGAGGTGCTTGG - Intronic
1170059897 20:12247888-12247910 TAGAGGAGTGGGGAGGTGAGGGG + Intergenic
1171399782 20:24865388-24865410 TAGGGCCTTTGGGAGGTGATTGG - Intergenic
1172112398 20:32554768-32554790 TAGGGGACAAGGAAGGGGCTAGG + Intronic
1172242519 20:33422934-33422956 TAGGGGACTGCGGAGGTGATGGG - Intronic
1173095884 20:40027792-40027814 TTGGGGACTCGGGAGGGGGTTGG - Intergenic
1173253015 20:41374557-41374579 AAGGGGCCTGGGGAGGTGAGAGG + Intergenic
1173475812 20:43358593-43358615 TAGGAGACCAGAGAGGTGAAAGG + Intergenic
1173749776 20:45468237-45468259 TTGGGGACTGGGGACGTTATTGG - Intergenic
1174602271 20:51734332-51734354 TTGGGCACTGAGGAGGTGATTGG - Intronic
1175067374 20:56300937-56300959 AAGGCAACTAGAGAGGTGATAGG + Intergenic
1175277799 20:57783665-57783687 TAGGGGGGTAAGGAGGTGACGGG - Intergenic
1176093790 20:63330349-63330371 TAGGGGACTCGGCAGGGGCTAGG + Intronic
1178322278 21:31614736-31614758 CAGGGGAATAGGGAGGGGAAGGG + Intergenic
1178322289 21:31614759-31614781 GAGGGGAATAGGGAGGGGAAGGG + Intergenic
1179373720 21:40830222-40830244 GAGGGGAGTAGGCAGGTCATAGG + Intronic
1179978157 21:44882448-44882470 CAGGGGTCTGGGCAGGTGATGGG + Intergenic
1180104258 21:45607589-45607611 GAGGGGAGAAGGGAGGTGAAAGG + Intergenic
1180468347 22:15636297-15636319 TGGGGCCCTAGGGAGGTGACAGG - Intergenic
1180707613 22:17818823-17818845 TGGGGGACTGGGTAGGGGATGGG + Exonic
1180993145 22:19950715-19950737 TAGGGAAGTATGGAGGTGATAGG + Intronic
1181751729 22:24993575-24993597 CATGTGACAAGGGAGGTGATGGG - Intronic
1183080721 22:35454378-35454400 GAGGGGAGAAGGGAGGTGCTCGG - Intergenic
1183276799 22:36903514-36903536 TAGGGGACTAGATGGGTGATGGG - Intergenic
1183433282 22:37778898-37778920 TAGGGGACTAAAGAGGAGCTGGG - Intergenic
1183475125 22:38031900-38031922 GAGGGGACTACGGATGTGTTTGG - Intronic
1183719528 22:39554408-39554430 TCCGGGTCTAGGGAGGTGGTAGG + Intergenic
1184342295 22:43892519-43892541 TAGGGGAGGAGGGAGGAGGTGGG - Intergenic
1184453075 22:44594380-44594402 TAGGTGAGGAGGGAGGTGGTCGG - Intergenic
950036674 3:9890918-9890940 GAGGGGACTTGGCAGGTGAGCGG - Intronic
950130698 3:10544346-10544368 TAGGCCCCTAGGCAGGTGATAGG - Intronic
950918129 3:16666016-16666038 TGGGGGAATGGAGAGGTGATAGG - Intronic
952896007 3:38079503-38079525 TAGGGGGCTTTGGAGGCGATCGG + Intronic
953002746 3:38950494-38950516 CAGGGGCCTTGGGAGCTGATTGG + Exonic
953077085 3:39581027-39581049 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
953177241 3:40563462-40563484 TAGGGGGCTTCCGAGGTGATCGG - Intronic
956012231 3:64844185-64844207 TGGGGGACTAGAGAACTGATGGG - Intergenic
956140193 3:66138671-66138693 TAGGGGAAGAGGGAGATGAAGGG + Intronic
956746944 3:72317924-72317946 TAAGGGACTAGGGAGGGGTGGGG - Intergenic
959206503 3:103313856-103313878 TTGGGGACTATGAAGGTGAACGG + Intergenic
959598980 3:108157816-108157838 TATGGGACAAGGTAGGTGACAGG + Intergenic
968313149 3:197700746-197700768 TAGGGGACCAGGAAGGAGGTGGG - Exonic
968836311 4:2966990-2967012 TGGGGCATTTGGGAGGTGATTGG + Intronic
969189294 4:5504014-5504036 TAGGGTCTTCGGGAGGTGATTGG + Intergenic
972080941 4:35148085-35148107 TAGGAGAATATGGAGGGGATAGG + Intergenic
973790078 4:54370192-54370214 TGGGGAAATAGGGAGGTGCTTGG - Intergenic
974819057 4:67043422-67043444 TAGTGGAGGAGGGAGATGATTGG - Intergenic
975763992 4:77648024-77648046 TAGGGGGCTAGGGGGGAGGTGGG + Intergenic
975776393 4:77792250-77792272 TAGGCACCTAGGGAGGTTATCGG - Intronic
976353321 4:84085047-84085069 TAGGGGAAGAAGGAGGGGATGGG - Intergenic
976448566 4:85160786-85160808 TGGGGGACTAGGGGAGGGATAGG - Intergenic
976884525 4:89968024-89968046 TAGGGGGCTTCTGAGGTGATCGG + Intergenic
977012879 4:91657850-91657872 TAGGGGTCTTCCGAGGTGATCGG + Intergenic
978100133 4:104828818-104828840 TAGAGAACTAGGGAGTTGGTGGG - Intergenic
979126224 4:116975646-116975668 TAGGGGATTATGGAGATTATGGG + Intergenic
979850263 4:125564864-125564886 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
983659617 4:170118933-170118955 TAGGGGGCTTCCGAGGTGATTGG - Intergenic
984437308 4:179722929-179722951 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
986325535 5:6670506-6670528 TTGGAGACTAAGGAGGAGATGGG - Intergenic
988630645 5:32927740-32927762 GAGGGGACAGGGGAGTTGATGGG - Intergenic
989074351 5:37547775-37547797 TGGGGGATTAGGGAGGAGGTAGG - Intronic
993035017 5:82747123-82747145 TCGGGGACTAGGAAGGTTACTGG - Intergenic
994200106 5:96964035-96964057 GAGGGGACAAGGGAGAAGATGGG - Intronic
994532500 5:100987482-100987504 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
996469111 5:123838854-123838876 TGGGGGCCTAGGGAGGAGGTTGG + Intergenic
996771287 5:127088540-127088562 TAAGGGTCTAGGGAGGAGAGAGG + Intergenic
998887048 5:146705735-146705757 TAGGGGGTTGGGGAGGGGATAGG + Intronic
998995436 5:147865758-147865780 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
998996356 5:147872214-147872236 TAGGGGGCTTCCGAGGTGATCGG + Intronic
1000657333 5:163895795-163895817 TAGGGCCCTCGGGAAGTGATTGG - Intergenic
1000935595 5:167301118-167301140 TAGGGGGCTTCCGAGGTGATCGG + Intronic
1001644375 5:173269302-173269324 CAGGGGATTAGGGAGGTGACAGG - Intergenic
1001793489 5:174481981-174482003 AAGGGAATTAGTGAGGTGATGGG + Intergenic
1002307814 5:178294079-178294101 TGGGAGACTGGGGTGGTGATGGG - Intronic
1002700926 5:181124406-181124428 TTGAGGAATGGGGAGGTGATGGG - Exonic
1002705168 5:181155819-181155841 TTGAGGAACAGGGAGGTGATGGG + Exonic
1004336584 6:14769805-14769827 TAGGGCCTTTGGGAGGTGATTGG + Intergenic
1004695601 6:18029990-18030012 TAAGGGATTTGGGAGGAGATTGG - Intergenic
1004768528 6:18757297-18757319 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
1005974128 6:30784391-30784413 CAGGGGACTAAGGTGGTGAGAGG - Intergenic
1007950227 6:45865601-45865623 AAGAGGACCAGGGAGGTGATTGG + Intergenic
1008190947 6:48456299-48456321 TAGGGAACTAGGGAGGTTTTGGG - Intergenic
1012066498 6:94557172-94557194 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
1013304895 6:108838700-108838722 GAGGGGTCTGGGGAGGTGACTGG + Intergenic
1018414716 6:163591070-163591092 GAGGGGACTATAGAGGGGATGGG - Intergenic
1018967459 6:168499777-168499799 TAGGGGACTGTGGAGCAGATTGG + Intronic
1019997668 7:4735077-4735099 TTGTGGCCTAGGGAGGGGATGGG + Intronic
1020532669 7:9356648-9356670 TAGGGGACTTCCGAGGCGATCGG + Intergenic
1021936785 7:25639060-25639082 TAGGGGACTGGGGAGGGCGTGGG + Intergenic
1023396867 7:39759562-39759584 AAGGGGACTAGGGATGGGGTAGG - Intergenic
1027851993 7:83462143-83462165 TAGGGGGCTTCCGAGGTGATCGG - Intronic
1028237703 7:88381890-88381912 TAGTTGAATAGGGATGTGATGGG - Intergenic
1029558374 7:101286149-101286171 TAGAGGCCCAGGGAGGTGACTGG - Intergenic
1030105534 7:105983893-105983915 TGGGGGAAGAAGGAGGTGATAGG - Intronic
1031681421 7:124680251-124680273 GAGGGGAGTAGGGAAGTGCTGGG + Intergenic
1031685893 7:124731514-124731536 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1034084786 7:148313282-148313304 TAGGGGGCTTCCGAGGTGATCGG + Intronic
1035792087 8:2316362-2316384 TGGGGGACTGGGGAGGTGTGGGG + Intergenic
1035800718 8:2405343-2405365 TGGGGGACTGGGGAGGTGTGGGG - Intergenic
1036065234 8:5373131-5373153 AAGGGTACTGGGGAGGTGAGGGG + Intergenic
1036701262 8:11015515-11015537 TAGGGGAAGAGGGAGGAGAGGGG + Intronic
1037773955 8:21820472-21820494 AAAGGGACAATGGAGGTGATGGG - Intergenic
1038308096 8:26422537-26422559 TAGGGGACTGGGAAGGAGACGGG + Intronic
1038376734 8:27047561-27047583 GAGGGGAGTAGGGAGGGGTTGGG - Intergenic
1041862693 8:62532335-62532357 TAGGGGACTGGGCAGGGGATAGG - Intronic
1042507588 8:69577499-69577521 TAGGGAACCTGGGAGGTGAAAGG - Intronic
1044173815 8:89091279-89091301 GAGGGCAGTGGGGAGGTGATGGG + Intergenic
1045491598 8:102674395-102674417 AAGGTGCCTAGGGAGGTGGTGGG - Intergenic
1046443292 8:114284467-114284489 TAGGGGGCTTCCGAGGTGATTGG - Intergenic
1048514478 8:135093499-135093521 TAGTGGACAAGGGAAGTGAGAGG + Intergenic
1048870100 8:138790328-138790350 TGGGGCTCTTGGGAGGTGATTGG - Intronic
1049463114 8:142739245-142739267 GCGGGGTCTAGGGAGGTGAGTGG - Intergenic
1050406460 9:5314009-5314031 TAGGTGCCTAAGGTGGTGATGGG - Intergenic
1051163899 9:14240332-14240354 TAGGGGACTAGGTAGGAAATTGG - Intronic
1051379872 9:16445618-16445640 GAGGAGAGTAGGGATGTGATTGG - Intronic
1051496196 9:17725967-17725989 TAGGGGTGTAGGGAGGGTATGGG + Intronic
1051512382 9:17892797-17892819 TGTGGGAGTGGGGAGGTGATGGG - Intergenic
1053564629 9:39235982-39236004 TGGGGGGCTGGGGAGGAGATGGG + Intronic
1053632517 9:39958627-39958649 TGGGGGACAGGGGAGGTCATGGG + Intergenic
1053773243 9:41504904-41504926 TGGGGGACAGGGGAGGTCATGGG - Intergenic
1054132523 9:61383052-61383074 TGGGGGGCTGGGGAGGAGATGGG - Intergenic
1054211371 9:62292070-62292092 TGGGGGACAGGGGAGGTCATGGG - Intergenic
1054313612 9:63556782-63556804 TGGGGGACAGGGGAGGTCATGGG + Intergenic
1054704930 9:68452592-68452614 TAGGGGAAGAGGAAGGAGATGGG - Intronic
1055492079 9:76815547-76815569 TAGGGGACTAGGGAGGTGATTGG - Intronic
1057141070 9:92727144-92727166 TAGGGGCCCAGGGAGGAGCTTGG - Intronic
1057378035 9:94542300-94542322 TACGGGACTTCCGAGGTGATTGG - Intergenic
1058879666 9:109275412-109275434 TATAGGACCTGGGAGGTGATTGG - Intronic
1058983165 9:110188738-110188760 TGGGGTATTTGGGAGGTGATTGG + Intergenic
1059801165 9:117750819-117750841 CAGGTGGCTATGGAGGTGATTGG - Intergenic
1060748592 9:126154134-126154156 TAGATGACTAGGGAGGTGGAAGG + Intergenic
1062021318 9:134320716-134320738 TTGGGGACTGGGGTGGAGATGGG + Intronic
1062324335 9:136005038-136005060 TGGGGGACAAGGGATGGGATGGG + Intergenic
1185450134 X:277228-277250 CAGGGGACTTGGGATGTGAGGGG + Intronic
1185450448 X:278149-278171 CAGGGGACTTGGGATGTGAGGGG + Intronic
1185631434 X:1518523-1518545 TGGGGGACTAGGGAGCTTTTGGG - Intronic
1185631555 X:1519153-1519175 CTGGGGATCAGGGAGGTGATTGG - Intronic
1185631641 X:1519719-1519741 TTGGGGACCAGGGAGATGATTGG - Intronic
1185631680 X:1519928-1519950 TTGGGGACCAGAGAGATGATTGG - Intronic
1188684493 X:33053183-33053205 CTGGGGACTAGGGAGATGATAGG + Intronic
1191816054 X:65246195-65246217 CAGGTAACTAGGGAGGTGAAAGG + Intergenic
1192962632 X:76146181-76146203 GAGGTGACTAGGAAGGTCATAGG + Intergenic
1193941544 X:87684373-87684395 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
1194367152 X:93025413-93025435 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
1198191034 X:134306145-134306167 TAGGGGACTGGCAAGGAGATGGG + Intergenic
1200395221 X:155982217-155982239 GAGGGACCTAGTGAGGTGATTGG + Intergenic