ID: 1055494395

View in Genome Browser
Species Human (GRCh38)
Location 9:76840380-76840402
Sequence GCATGCTGGTGTGCTGTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055494395_1055494402 12 Left 1055494395 9:76840380-76840402 CCATTTACAGCACACCAGCATGC 0: 1
1: 0
2: 2
3: 10
4: 100
Right 1055494402 9:76840415-76840437 CATTCTAGGATACAGCCACGGGG No data
1055494395_1055494400 10 Left 1055494395 9:76840380-76840402 CCATTTACAGCACACCAGCATGC 0: 1
1: 0
2: 2
3: 10
4: 100
Right 1055494400 9:76840413-76840435 TGCATTCTAGGATACAGCCACGG No data
1055494395_1055494401 11 Left 1055494395 9:76840380-76840402 CCATTTACAGCACACCAGCATGC 0: 1
1: 0
2: 2
3: 10
4: 100
Right 1055494401 9:76840414-76840436 GCATTCTAGGATACAGCCACGGG No data
1055494395_1055494397 -2 Left 1055494395 9:76840380-76840402 CCATTTACAGCACACCAGCATGC 0: 1
1: 0
2: 2
3: 10
4: 100
Right 1055494397 9:76840401-76840423 GCCCAAGCATGATGCATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055494395 Original CRISPR GCATGCTGGTGTGCTGTAAA TGG (reversed) Intronic
901334290 1:8435614-8435636 GCATGCAGGTGTGTTGACAAAGG - Intronic
903781540 1:25823179-25823201 GCCTGCTGAAGTACTGTAAAAGG + Intronic
909516681 1:76516172-76516194 GCCAGCTGTTGTGCTGGAAATGG + Intronic
911628506 1:100155678-100155700 GCATACTGCTTTGCTATAAATGG - Intronic
916347300 1:163808076-163808098 GAATGATGGTCTGATGTAAAAGG + Intergenic
917087574 1:171319191-171319213 GCTTGCTGGGGAGCTGGAAAGGG + Intronic
1064360935 10:14663553-14663575 GCATTGTGGTTTGCTGTCAATGG - Intronic
1065078472 10:22104127-22104149 GCATTCTGGTGTGCTGCTATTGG - Intergenic
1066379483 10:34889118-34889140 CCCTGATGGTGTGCTGGAAATGG - Intergenic
1066431702 10:35358146-35358168 TTATGGTGGTGTTCTGTAAAGGG - Intronic
1066496959 10:35951272-35951294 GCAAGCTGGTGAGCTGTGCAGGG + Intergenic
1067721905 10:48733733-48733755 GAATGCTGATGTGCTCAAAATGG + Intronic
1068903857 10:62300729-62300751 TCATGCTGGTGTCCTTTACAAGG - Intergenic
1075650345 10:124123927-124123949 CCATGCTGGTGAGCTGGAAGGGG - Intergenic
1076045234 10:127287724-127287746 GCTTGCTGGTGTGATGCAATGGG - Intronic
1079248681 11:18771799-18771821 GCATGCTGGTTTCATGGAAAAGG + Intronic
1079960053 11:26912949-26912971 GTACACTGGTGTGCTGTAACTGG - Intergenic
1084680569 11:70663983-70664005 CCATGCTGGTGTGGTGTAATAGG + Intronic
1085482124 11:76831272-76831294 GCAGGTATGTGTGCTGTAAAGGG + Intergenic
1089088909 11:115849628-115849650 GCAAGCAGGTGTGCTGGAAATGG - Intergenic
1097699985 12:62810000-62810022 GCATACTGGTGTACAGAAAATGG - Intronic
1100335292 12:93623506-93623528 CCATGCTGGTGTGCTGCACCGGG + Intergenic
1108563131 13:51666442-51666464 GCCTACTGGTGTGGTCTAAATGG + Intronic
1108875129 13:55037959-55037981 GCATATTGGTATGCTGCAAAAGG + Intergenic
1111723911 13:91980748-91980770 GGATCCTGGTGTGCTGGTAATGG - Intronic
1113764030 13:112869735-112869757 GGAGGCTGCTGTGCTGTAACTGG - Intronic
1116677411 14:47923604-47923626 GAATTCTGGTGTGGTGCAAAGGG - Intergenic
1120113090 14:80581450-80581472 TCATGCTGGTGTGTTGTAACTGG + Intronic
1121440233 14:93944370-93944392 ACATGCGGGTGTGCTGAGAAAGG - Intronic
1123781658 15:23634333-23634355 CCCTGCTGGGGTGCTGTTAAGGG + Intergenic
1124805651 15:32879500-32879522 GGATGCTGGTGTGTTCTAGAAGG - Intronic
1125474056 15:40032629-40032651 AGATGCTATTGTGCTGTAAAAGG - Intronic
1126990273 15:54366893-54366915 GTATCCTGCTGTGCTGTAACAGG - Intronic
1127657938 15:61073168-61073190 TCTTGCTTCTGTGCTGTAAACGG + Intronic
1129888822 15:79057547-79057569 GCATGCTGGTGAGGTGATAAGGG + Intronic
1133076861 16:3286456-3286478 GGATGCTGGGGGGCTCTAAATGG + Intronic
1138691534 16:58773368-58773390 GGATGCTGTTGTGGAGTAAAAGG + Intergenic
1139175359 16:64680886-64680908 GCATGCTGGAGTGCAGTGACAGG + Intergenic
1148492344 17:48031410-48031432 CCAGGCTGGTGTGCAGTAAGTGG - Intronic
1149597729 17:57874161-57874183 GCATGCTGGTTTGCTGAGGAAGG + Intronic
1149722882 17:58863717-58863739 GTGTGCTGGGGTGCTGGAAAGGG + Intronic
1151355874 17:73558145-73558167 GGGTGCAGGTCTGCTGTAAAGGG + Intronic
1153368142 18:4282777-4282799 GCATGCTGCTGTGTCGTAACTGG - Intronic
1157588273 18:48819035-48819057 GCATGCTATTGTTCTATAAACGG - Intronic
1158130884 18:54151344-54151366 GCATGCTGGTTTTCTCTATAAGG - Intergenic
1158518582 18:58151191-58151213 GCATCCTGGAGTGGTGTCAAGGG + Intronic
1163847176 19:19644142-19644164 GCTCCCTGGTGTGCTGTAATTGG - Intergenic
1165350442 19:35272339-35272361 GCATGGTAGTGTGCTCTGAAGGG + Intronic
931062149 2:58542638-58542660 GCATGCACGTGTGATGTAAAAGG - Intergenic
935101189 2:99997712-99997734 GCATGCTGCAGTGGTGTACATGG - Intronic
940152650 2:150619670-150619692 TCATGCTGGTGTTATGAAAATGG + Intergenic
940833095 2:158490507-158490529 GAATGCTGTTGAGTTGTAAATGG + Intronic
942838102 2:180325634-180325656 ACATGCTTATGTGCTGGAAATGG - Intergenic
1168792731 20:590775-590797 GCATGCTGGTGTTCAGTAAATGG - Intergenic
1169244929 20:4017599-4017621 CCATGGTGCTGTTCTGTAAATGG - Intergenic
1169548838 20:6680158-6680180 ACAAGATGGTGTGCTGTGAATGG - Intergenic
1172681837 20:36722146-36722168 GCAAGCTGATGTGCTGTGAGAGG + Intronic
1177816842 21:25987032-25987054 ACATGCTGGGGCACTGTAAAGGG + Intronic
1178085121 21:29104713-29104735 GCTTCCTGGAGTGCTGTAATTGG - Intronic
1179488487 21:41726042-41726064 GCACGCTGGTGTCCTTTAGAAGG + Intergenic
1179543393 21:42099098-42099120 GGAGGCTGGAGTGCTGTACAGGG + Exonic
1180185033 21:46135273-46135295 GGATGCTGGTGTGGTGTAATTGG - Intergenic
1181646196 22:24232854-24232876 GGATGCTGTTGTGCAGGAAACGG + Exonic
1182004588 22:26949329-26949351 GCTTCCTGGTGTGCAGTAAATGG - Intergenic
1184927601 22:47654254-47654276 ACAAGCTGGTGTGATGGAAAGGG + Intergenic
1185312535 22:50164250-50164272 GCTTGCTGGTGTCCTCTAAGTGG - Intergenic
949938169 3:9133549-9133571 GAATTCTAGTGTGCTGTAAAAGG - Intronic
951074421 3:18372155-18372177 ATATGCTGGATTGCTGTAAAGGG + Intronic
952595627 3:35014410-35014432 CCATGCTGGTGTGCTGCACCCGG + Intergenic
952868286 3:37873148-37873170 CCATGCTGGAGTGGTGTTAAAGG - Intronic
959575516 3:107928593-107928615 GCATGCTGCTGTGCTGTATCAGG - Intergenic
960948145 3:122981108-122981130 GCAGGCTGGTGTGTGTTAAATGG + Intronic
963186799 3:142427788-142427810 GCATGCTGGTACGCTGCAAAGGG - Intronic
969468502 4:7371898-7371920 GCATGCTGGTGGCCTCTAGAAGG + Intronic
974465442 4:62249566-62249588 ACATGCTGATGTGATATAAATGG - Intergenic
975243887 4:72095235-72095257 GTCTGCTGGTGTGCTGGAACTGG + Intronic
975526577 4:75357336-75357358 CCATGTTGGTGTGCTGGAAGAGG - Intergenic
976138518 4:81964698-81964720 GCCTGCCGGTGTCCTGAAAAAGG + Intronic
983557495 4:169071482-169071504 GCATCCAGGGGTGCTGTCAAGGG - Intergenic
992698839 5:79319057-79319079 AGCTGCTGGTGTGCTGTGAATGG - Intronic
998323284 5:141253552-141253574 GGAAGCTGGTCTGCAGTAAAAGG - Intergenic
998846812 5:146318364-146318386 CCATGTTGGTGTGCTGGACAGGG - Intronic
1001151826 5:169236294-169236316 GCATGTTGTTGTGCCATAAAGGG - Intronic
1001741033 5:174052798-174052820 GCATGCACGTGTGCTGGGAAGGG + Intronic
1012905138 6:105055509-105055531 GCCTGCTGCTGTGCTTTGAAGGG - Intronic
1020778927 7:12494046-12494068 GCATTTTGGAATGCTGTAAAAGG + Intergenic
1021160142 7:17262952-17262974 GCAAGCTGTAGTGCTGGAAAAGG - Intergenic
1021920959 7:25484300-25484322 GCATGCTGGTGTGGTGTGAAGGG + Intergenic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1022965521 7:35467959-35467981 GCATGTGGGTGTGCTGGGAAGGG + Intergenic
1023368974 7:39493355-39493377 ACATGTTGATGTGCTTTAAATGG + Intergenic
1026038270 7:66845351-66845373 GCAGGCTGGAGTGCTGTGATGGG - Intergenic
1026075322 7:67161511-67161533 GCATGCCTGTGTGCTCTAACGGG + Intronic
1026701529 7:72650692-72650714 GCATGCATGTGTGCTCTAACAGG - Intronic
1027245001 7:76360708-76360730 CCATGCTGGAGTGCAGTAGAGGG - Intergenic
1032815403 7:135468767-135468789 ACATGCTAATTTGCTGTAAAGGG - Intronic
1036194209 8:6699740-6699762 GCCTCCTGGTGTGCTGGGAAGGG + Intergenic
1036219443 8:6908924-6908946 GCATCCTGAAGTCCTGTAAATGG - Intergenic
1046841884 8:118868194-118868216 GAATGCTGGTCTGCAGTGAAAGG + Intergenic
1047200430 8:122760643-122760665 TCAAGCTGGTGCTCTGTAAATGG + Intergenic
1048555306 8:135470197-135470219 GCATCCTGGCGTGCTGATAAAGG + Intronic
1052169679 9:25377652-25377674 GCAGGATGGGGAGCTGTAAAGGG + Intergenic
1053048939 9:34942455-34942477 GCATGCTGATGTGCTCTAGAGGG - Intergenic
1055494395 9:76840380-76840402 GCATGCTGGTGTGCTGTAAATGG - Intronic
1055554527 9:77461226-77461248 CCATGCTGGTGTGCTGTGGCTGG - Intronic
1056770965 9:89478157-89478179 GCCTTCTTGTGTGCTGTAACAGG + Intronic
1057221524 9:93260161-93260183 GCATGCTGGCTGGCTGTGAAGGG + Intronic
1061433730 9:130547469-130547491 GCACGCTGGTGTTCAGAAAACGG + Intergenic
1186203372 X:7176459-7176481 ACATGCTGATGGGGTGTAAAGGG - Intergenic
1192021269 X:67394309-67394331 AAATACTGGTGTGGTGTAAATGG - Intergenic
1192221762 X:69202174-69202196 GCCTTCTGGAGTGCTGAAAATGG - Intergenic
1195745648 X:108115001-108115023 GCATTCTGCAGTGCTATAAATGG + Intronic
1198834669 X:140791558-140791580 GCACACTGGTGTCCTGTGAATGG - Intergenic