ID: 1055495012

View in Genome Browser
Species Human (GRCh38)
Location 9:76845454-76845476
Sequence GTGCTTACTTAGTTTAGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055495006_1055495012 26 Left 1055495006 9:76845405-76845427 CCCCAATTACCTTCATTTTCCTT 0: 1
1: 0
2: 4
3: 62
4: 672
Right 1055495012 9:76845454-76845476 GTGCTTACTTAGTTTAGTTGAGG No data
1055495007_1055495012 25 Left 1055495007 9:76845406-76845428 CCCAATTACCTTCATTTTCCTTC 0: 1
1: 1
2: 6
3: 43
4: 592
Right 1055495012 9:76845454-76845476 GTGCTTACTTAGTTTAGTTGAGG No data
1055495008_1055495012 24 Left 1055495008 9:76845407-76845429 CCAATTACCTTCATTTTCCTTCT 0: 1
1: 1
2: 6
3: 80
4: 734
Right 1055495012 9:76845454-76845476 GTGCTTACTTAGTTTAGTTGAGG No data
1055495010_1055495012 7 Left 1055495010 9:76845424-76845446 CCTTCTGCTCTGTCACAAAGATA 0: 1
1: 0
2: 1
3: 22
4: 396
Right 1055495012 9:76845454-76845476 GTGCTTACTTAGTTTAGTTGAGG No data
1055495009_1055495012 17 Left 1055495009 9:76845414-76845436 CCTTCATTTTCCTTCTGCTCTGT 0: 1
1: 0
2: 19
3: 312
4: 2007
Right 1055495012 9:76845454-76845476 GTGCTTACTTAGTTTAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055495012 Original CRISPR GTGCTTACTTAGTTTAGTTG AGG Intronic
No off target data available for this crispr