ID: 1055495054

View in Genome Browser
Species Human (GRCh38)
Location 9:76845894-76845916
Sequence AGCCACCTGCTTCCAAAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055495054_1055495056 23 Left 1055495054 9:76845894-76845916 CCACTCTTTGGAAGCAGGTGGCT 0: 1
1: 0
2: 2
3: 26
4: 173
Right 1055495056 9:76845940-76845962 ATTACTAGAGTAACTGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055495054 Original CRISPR AGCCACCTGCTTCCAAAGAG TGG (reversed) Intronic
901128111 1:6943381-6943403 AGGCACCTGATTTCAGAGAGCGG + Intronic
901755488 1:11439089-11439111 AAGCAGCTGCTACCAAAGAGGGG - Intergenic
904415342 1:30358033-30358055 AGACACCTGCCTCCCAGGAGGGG + Intergenic
904790731 1:33018652-33018674 AACCACCTACTTCCAAATGGAGG + Intronic
906792145 1:48668444-48668466 AGCCACCAGCTACCAGAGACAGG - Intronic
914440423 1:147700665-147700687 AGCCACCTGTTTGCAGAGAGAGG - Intergenic
916514835 1:165506558-165506580 AGACACCTGCTATCAAAGATCGG + Intergenic
917503832 1:175610527-175610549 GGCCAGCTGCTTCCCAGGAGGGG - Intronic
920383973 1:205554303-205554325 TGCCACCTCATTCCAAAAAGAGG + Intergenic
924182370 1:241451956-241451978 AGCCATCTGCTTCAGAATAGTGG + Intergenic
924824962 1:247529847-247529869 ACTGACCTGCTTCCAAAAAGAGG + Intronic
1063008446 10:1997386-1997408 AGCCTCCAGCTTCCAAAGCCTGG - Intergenic
1063169465 10:3494608-3494630 ACACAGCTGCTTCTAAAGAGAGG - Intergenic
1064565435 10:16634353-16634375 AGCCACAAGATTCCAAACAGTGG + Intronic
1069425787 10:68287630-68287652 AGCCCACTGTTCCCAAAGAGAGG + Intronic
1069624798 10:69861048-69861070 ACCCTCCTGCGTCCACAGAGAGG + Intronic
1069673968 10:70233787-70233809 AGTCACCTGCTTCCCCAGACAGG + Intronic
1069736863 10:70662211-70662233 AGCCATATGTTTCCAAAGAGGGG + Intergenic
1070027132 10:72642431-72642453 AGTCACCCGCTTCCAATGTGTGG - Intergenic
1070591578 10:77805655-77805677 AGCCACTTGCCTTCAAAGAGTGG + Exonic
1073799440 10:107025412-107025434 AGTCACCTGATTCAAAAGAGAGG - Intronic
1074543401 10:114384694-114384716 AAACACCTACTTCCAGAGAGAGG + Intronic
1075402956 10:122173923-122173945 AGCCACCTGCTCCCATAGACAGG + Intronic
1078897574 11:15610975-15610997 AGCCAACTTCTTCCAGAAAGTGG + Intergenic
1079677771 11:23252695-23252717 GGCAACCTGCCTTCAAAGAGAGG - Intergenic
1080909267 11:36579276-36579298 AACCACCTGCATCCAAATAATGG - Exonic
1085294985 11:75426419-75426441 AGACCCCTTCTTACAAAGAGAGG + Intronic
1086446367 11:86875138-86875160 AGCCACCTACATTCAAGGAGAGG + Intronic
1088818419 11:113437035-113437057 CGCCACCTGCTGTGAAAGAGAGG - Intronic
1090213030 11:124936210-124936232 AGATACCTGCTTCCAAACTGGGG - Exonic
1091863826 12:3812234-3812256 TGCGACCTCCTTCCAAAGACGGG - Exonic
1092681812 12:10991628-10991650 AGCCACATGGTTCAATAGAGAGG - Intronic
1093790070 12:23238361-23238383 AGAGACCTGCTTCTAAAGAATGG + Intergenic
1094830644 12:34298636-34298658 AGGCACTTTCTTCCAAAGGGCGG - Intergenic
1100564687 12:95783898-95783920 AGCCACCTCCATCAACAGAGTGG - Intronic
1102008394 12:109603176-109603198 AGCCACTTACTTGCACAGAGAGG + Intergenic
1102482255 12:113232032-113232054 AGCCAGCTGCTGCCTAAGATGGG + Intronic
1102779698 12:115553423-115553445 AGCCACCAGCTTCCAAAACAAGG + Intergenic
1103191323 12:119004582-119004604 AGCCTCCTGCTAGCAAAGGGTGG + Intronic
1104843480 12:131835377-131835399 AACCACCTGCTTCCAAACATTGG + Intronic
1105617428 13:22031568-22031590 AGACACATGGTTCCAATGAGAGG - Intergenic
1105812367 13:24006899-24006921 AGCATCCTCCTTCCAGAGAGGGG - Intronic
1111391134 13:87596403-87596425 AGCCAGCTGCTTCAGAATAGTGG - Intergenic
1111405408 13:87797820-87797842 AGCTAATTGCTTCCAAAGATGGG - Intergenic
1111895243 13:94133882-94133904 ATCCACCTCCTGCCAAAGACAGG + Intronic
1116782626 14:49252714-49252736 AGCAACCTGCTAACAAACAGAGG + Intergenic
1117967944 14:61224798-61224820 AGAAACTTGCTTCCAAAGAGTGG - Intronic
1119553336 14:75533641-75533663 AGTCCCCTGCTTCCTAGGAGGGG + Intronic
1119679529 14:76581794-76581816 AGCCACCATCTTCCCAAGAGAGG - Intergenic
1121879520 14:97487568-97487590 GGCCACATGCTTTCTAAGAGAGG - Intergenic
1122770390 14:104095202-104095224 AGCCCCCTGCTGCCATGGAGAGG + Intronic
1123676651 15:22715471-22715493 AGGCACCTGCTCCCACAGAAGGG + Intergenic
1124328867 15:28789734-28789756 AGGCACCTGCTCCCACAGAAGGG + Intergenic
1126950955 15:53880666-53880688 AGCAACTTGCTTTTAAAGAGAGG - Intergenic
1126994252 15:54421640-54421662 AATCACCTGCTTCCACACAGCGG - Intronic
1129128464 15:73466952-73466974 AGCCAACTGCATCCTAAGAAAGG + Intronic
1129744486 15:78008413-78008435 AGGCACCTGCCTCCACAGATGGG - Intronic
1129833575 15:78686595-78686617 AGCCATCTTATTCCAAAGACTGG - Intronic
1130180788 15:81625922-81625944 AGCCAGCTGCCTGCAAAGTGTGG - Intergenic
1130871882 15:87978225-87978247 GGCCACCCTCTCCCAAAGAGGGG - Intronic
1132145320 15:99425895-99425917 AGCCAACTTCTTCCAGGGAGCGG - Intergenic
1132283498 15:100641718-100641740 AGACTCCAGCTTCCAAAGAGGGG + Intronic
1133211792 16:4267364-4267386 AGCCTCCTGGGTCCAAACAGGGG + Intronic
1134022262 16:10929442-10929464 AGGCACCTGCTCCCACAGAAGGG - Exonic
1134674858 16:16083038-16083060 AAACCCCTGCTTCCAAAGAGTGG - Intronic
1135691184 16:24539368-24539390 AACCATCTGCTTCAAAAGGGAGG - Intronic
1137561574 16:49505776-49505798 TGGGACCAGCTTCCAAAGAGTGG - Intronic
1138881515 16:61021223-61021245 AACCACCTGCATCAAAAGAATGG + Intergenic
1139095754 16:63703220-63703242 AGGCACCTGCTTCTGGAGAGAGG - Intergenic
1139852724 16:69960728-69960750 GGCCACCTGCTCCAAAAGAGTGG - Intronic
1139881695 16:70183636-70183658 GGCCACCTGCTCCAAAAGAGTGG - Intronic
1140246283 16:73252895-73252917 GGCCACCGGAGTCCAAAGAGAGG + Intergenic
1140370813 16:74411870-74411892 GGCCACCTGCTCCAAAAGAGTGG + Intronic
1141411125 16:83833839-83833861 AGTGACTTCCTTCCAAAGAGGGG + Intergenic
1143668774 17:8382029-8382051 AGACTCTTGCTCCCAAAGAGTGG - Intronic
1144659323 17:17058246-17058268 AGGTCCCTGCTTGCAAAGAGGGG - Intronic
1145991617 17:29082475-29082497 AGGCACCTGCTGCCCACGAGGGG + Intronic
1146489623 17:33271053-33271075 AGCCTCCTGCTTCTAAACAGGGG + Intronic
1149538275 17:57449231-57449253 AGCTCCATCCTTCCAAAGAGGGG - Intronic
1150022628 17:61634160-61634182 AAGCACCTGCATCAAAAGAGTGG - Intergenic
1150598570 17:66629351-66629373 AGCTCCCTACTACCAAAGAGTGG + Intronic
1151237014 17:72728020-72728042 AGCCTCCTGCTTCAACAGACAGG + Intronic
1151817769 17:76479620-76479642 GGCCTCCTCCTTCCAGAGAGGGG + Intronic
1155538208 18:26839839-26839861 AGCTGCCTGCTGCCAGAGAGGGG - Intergenic
1156261003 18:35444999-35445021 AGCCACCTGCTTCAGGAAAGAGG + Intronic
1157193283 18:45598999-45599021 AGCCACTGGTTTCCAAAAAGAGG + Intronic
1157828750 18:50837031-50837053 AGCTTCCTGCTTCTACAGAGAGG - Intergenic
1158091102 18:53714712-53714734 AGTCACCTGCTTGGAAACAGCGG + Intergenic
1161373269 19:3925559-3925581 AGCCACCTGCATTCAAAGCTTGG + Exonic
1163055185 19:14712630-14712652 TGCCACCTGCTTTCTAACAGTGG + Intronic
1163094117 19:15043249-15043271 ACCCACCTGCCTCCACACAGGGG + Intergenic
1164063615 19:21695573-21695595 GGCCACCTGGTTCCAAACTGTGG + Intergenic
1165048047 19:33121909-33121931 AGCTAACTGCTTTCAAAGACAGG + Intronic
1166556001 19:43700209-43700231 AGCCTCCTTCTTCAAACGAGGGG + Intergenic
1167254147 19:48417264-48417286 AGCCACTTGCTTCCACAGAGTGG - Intronic
1167338046 19:48898595-48898617 GGTCCCCAGCTTCCAAAGAGAGG - Exonic
1167707602 19:51090769-51090791 ACCCCCCAGCTTCCAAAGATAGG - Intergenic
1168325960 19:55538285-55538307 GGGCTCCTGATTCCAAAGAGAGG + Intergenic
932429025 2:71662395-71662417 ACACAACTGCATCCAAAGAGGGG - Intronic
932709006 2:74048224-74048246 AACCACCTGCTTCCATTCAGAGG + Exonic
933950073 2:87321444-87321466 AGCCACCTGCATCTCAAGAGTGG - Intergenic
936330115 2:111540153-111540175 AGCCACCTGCATCTCAAGAGTGG + Intergenic
938048552 2:128145937-128145959 CACCACCTTCTTCCAAAGAGCGG + Exonic
941644895 2:168029835-168029857 AGCCACCAGCTTTCCAAGAGAGG - Intronic
944667620 2:201970372-201970394 AGCGACCAGCTTCCAATGAGGGG + Intergenic
946336825 2:219043162-219043184 AGCCTCCACCTCCCAAAGAGTGG - Intergenic
948545811 2:238727959-238727981 AGCCTCATGCTTCCAAAGGAGGG - Intergenic
1169073241 20:2746501-2746523 TGCCACCAGCTCCCAAGGAGGGG + Intronic
1170710086 20:18782783-18782805 AGCCAGCTGCTTCCATTGATGGG + Intergenic
1170960286 20:21019802-21019824 AAACACCTGCTTCCAAACAGTGG + Intergenic
1172582638 20:36060448-36060470 AGTAACTTGCTTCCAAAGAGTGG + Intergenic
1176943718 21:14954150-14954172 AGCTCCCTGCTTCCAAAGCAGGG + Intergenic
1178079177 21:29045375-29045397 TGCAACCTACTTCCAAATAGAGG - Intronic
1178401693 21:32291794-32291816 ATCCACCTGCTGCCTCAGAGTGG - Exonic
1185041822 22:48508053-48508075 AGCCGCCCGCTTGCAGAGAGGGG + Intronic
951750871 3:26035076-26035098 ACTCTCCTGCTTCAAAAGAGTGG + Intergenic
954408029 3:50356237-50356259 AGCCTACTGCTTCCACAGGGTGG + Intronic
954620829 3:51994456-51994478 TGACACCTTCTTCTAAAGAGGGG - Intronic
954916079 3:54149568-54149590 AGCCACATCCTCTCAAAGAGAGG - Intronic
956435714 3:69232723-69232745 AGCCACCTGCTATCAGAGACTGG + Intronic
958626773 3:96635918-96635940 AAGCACCTGCTGCCAAAGATGGG - Intergenic
962391735 3:134978061-134978083 AGTCACCTGCTTCCTCAGAGGGG - Intronic
964721082 3:159767677-159767699 AGACACTTGCTTCCAAGCAGAGG - Intronic
966322569 3:178717225-178717247 GGCCACCTGTTTCCAAAGTATGG + Intronic
966685006 3:182683756-182683778 GCCCACCTTCTTCCACAGAGGGG - Intergenic
967016143 3:185483553-185483575 AGCAACCTGGCTCCAGAGAGGGG - Exonic
968271640 3:197407709-197407731 AGCCATCTGCCCCCACAGAGGGG - Intergenic
969867480 4:10085119-10085141 AGACAGCTGCTTCCAGAGGGCGG + Intronic
971222576 4:24722262-24722284 ACCCTGCTGCCTCCAAAGAGGGG + Intergenic
971307983 4:25500498-25500520 AGCCAGCAGTTTCCAAAGTGGGG - Intergenic
971446567 4:26756844-26756866 AGCCACCTGTTTCAAATGAAAGG - Intergenic
971664973 4:29471597-29471619 ATCTACCTGCTTTCACAGAGAGG - Intergenic
973636087 4:52862813-52862835 ACCCGCCTGCTTCCACAGACGGG + Intronic
976131888 4:81893207-81893229 AGCTAAGTGCTTCCAAAGGGAGG + Intronic
976467507 4:85387428-85387450 AGCCACCTCCATCCAAGGGGAGG - Intergenic
979583086 4:122382990-122383012 AGCCATCTGTAACCAAAGAGTGG + Intronic
982788061 4:159559129-159559151 AGCCAACTGCTTCCAGATAATGG + Intergenic
982897884 4:160957228-160957250 AGCCACCTGCTCCTAAAGGTGGG + Intergenic
983242413 4:165248495-165248517 AGACACGTGCTTCCAAGGAGCGG + Intronic
985587102 5:746139-746161 AGCCACGAGCTTCCATGGAGGGG + Intronic
985601673 5:838322-838344 AGCCACGAGCTTCCATGGAGGGG + Intronic
986276142 5:6276743-6276765 ATCCATCTGATTCCAAAGAGTGG - Intergenic
987500747 5:18706743-18706765 AGCCACCTGCTTCATAAAGGTGG + Intergenic
991009253 5:61865759-61865781 AGCCTCCTGTTTCCACAGAGAGG + Intergenic
991629325 5:68639060-68639082 AGTGACCTGCTTCTAAAGAATGG - Intergenic
993346031 5:86783666-86783688 AGCCATTGGCTTCAAAAGAGGGG - Intergenic
993552456 5:89290758-89290780 AGCCCTCTGATTCCACAGAGAGG - Intergenic
995021002 5:107367333-107367355 AGTCATCAGCTTCCAGAGAGAGG + Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
998946189 5:147341905-147341927 ACCCACCTTCTTCCAATGAAGGG + Intronic
999705150 5:154265765-154265787 ACCCACCTGCTTGCAAACTGGGG - Intronic
1001718043 5:173833198-173833220 AGCCACCTGTTTCAAAATACAGG - Intergenic
1003339105 6:5202698-5202720 TGCCAACTGCCTCCAAAGACAGG + Intronic
1003500207 6:6696903-6696925 GGCCAACTGCTTCCACCGAGAGG - Intergenic
1004168814 6:13279772-13279794 TGCACCCTGCATCCAAAGAGTGG - Intronic
1004287693 6:14337888-14337910 AGGCACTTGCTTACAAAGGGAGG + Intergenic
1006917351 6:37603107-37603129 AGCCTCCTGCTGCCACAGGGAGG - Intergenic
1006930571 6:37685642-37685664 AGACACCTGCTAGCAGAGAGAGG + Intronic
1011327225 6:86162226-86162248 AAGCACCTATTTCCAAAGAGAGG + Intergenic
1014930044 6:127324985-127325007 AGTAACTTGCTTCCAAGGAGTGG + Intronic
1018245161 6:161815673-161815695 AGCCTCCTGCCTTCAGAGAGTGG + Intronic
1019616797 7:1966916-1966938 AGCCACCTGCTCTCCAGGAGAGG + Intronic
1019638722 7:2090848-2090870 CGTGACCTCCTTCCAAAGAGTGG - Intronic
1019656023 7:2196348-2196370 AGCCACCTGTTTCCAAACCAGGG + Intronic
1019841659 7:3452328-3452350 AATCACCTGCTTCCAAAGAGTGG - Intronic
1020092219 7:5348181-5348203 AGACACTTGCTTCCAAGGACGGG + Intronic
1021261851 7:18468174-18468196 AGTGACTTGCTTCTAAAGAGTGG - Intronic
1021931785 7:25588176-25588198 AGCCACTTGCTTCCAAATGCAGG + Intergenic
1023766001 7:43511349-43511371 AGTCAGCAGCATCCAAAGAGTGG - Intronic
1026186866 7:68088830-68088852 AGCCACCTGCTTGGTCAGAGGGG + Intergenic
1034408095 7:150919495-150919517 AGGGACTTGCTTCCAAAGAACGG - Intergenic
1034490773 7:151392134-151392156 AGCCATGTGCTCCCCAAGAGTGG + Intronic
1034964703 7:155383977-155383999 AACCCCCTGCTTCCCAGGAGGGG + Intronic
1036975589 8:13407577-13407599 ACCCAGATGCTTCCAAATAGTGG + Intronic
1036979823 8:13457725-13457747 AACCACCTGACTCCAAAGAAGGG - Intronic
1040996296 8:53406133-53406155 AGCCTCTTGCTTCCAAAGCTAGG + Intergenic
1041619232 8:59946205-59946227 AGTCATTTGCTTGCAAAGAGAGG + Intergenic
1042323143 8:67499365-67499387 AAGCACCTGGTTCCAAAGAATGG + Intronic
1042342586 8:67695652-67695674 AGCCAGCTGCTTCAAGATAGTGG - Intronic
1047408221 8:124602892-124602914 AGCCGCCTGCCCCCATAGAGTGG + Intronic
1049530937 8:143154650-143154672 GTCCACCTGCTTCAACAGAGTGG + Intergenic
1050030793 9:1383045-1383067 TGCAACCTGCATCCAGAGAGAGG - Intergenic
1052479098 9:28998781-28998803 AGCCACCTGCTTTTAAAAACAGG + Intergenic
1055495054 9:76845894-76845916 AGCCACCTGCTTCCAAAGAGTGG - Intronic
1056325745 9:85477301-85477323 GGCCATCTGCCTCCAAGGAGGGG - Intergenic
1060496954 9:124126018-124126040 GGAGACCTCCTTCCAAAGAGTGG - Intergenic
1060796372 9:126515101-126515123 AGCCACCAGCTCCCAAACTGGGG - Intergenic
1061450087 9:130663074-130663096 AGCTACCTGCTTCGGGAGAGGGG + Intergenic
1062186863 9:135222954-135222976 AGGCCCCTGCTTCCAATAAGCGG - Intergenic
1186632423 X:11364476-11364498 TCCCTCCTTCTTCCAAAGAGAGG + Intronic
1187034040 X:15518950-15518972 AGCCAACTTTTTCCCAAGAGTGG + Intronic
1187046664 X:15654070-15654092 GGCCAACTGCCTCCAAAGAGTGG + Intronic
1189312587 X:40030336-40030358 CGCCACCTGCTTGTAAAGAAAGG - Intergenic
1189602391 X:42640961-42640983 GGTCACCTGCTTCTGAAGAGTGG - Intergenic
1190759521 X:53427986-53428008 ATCCACCTGATCCCAAAGAAAGG - Exonic
1191128970 X:56988142-56988164 GGCCACATGCTTCCCAAGAAAGG - Intronic
1194438384 X:93897796-93897818 AGCCAAATGCTCCCAAACAGAGG - Intergenic
1194936981 X:99961913-99961935 GGTTACCTTCTTCCAAAGAGAGG - Intergenic
1195749401 X:108149204-108149226 ATCTACCTGCTGCCAAAGACTGG - Intronic
1196805708 X:119583876-119583898 AGTCAGCAGCTTGCAAAGAGAGG - Exonic
1198745419 X:139885198-139885220 ACCCACTCACTTCCAAAGAGAGG + Intronic
1198925894 X:141794933-141794955 AGCCAAATGCATCCAAAGAAAGG + Intergenic