ID: 1055503481

View in Genome Browser
Species Human (GRCh38)
Location 9:76924957-76924979
Sequence GGAGGCAGAAGATGTCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055503469_1055503481 16 Left 1055503469 9:76924918-76924940 CCCTGACTGATACAGTCTCCATT No data
Right 1055503481 9:76924957-76924979 GGAGGCAGAAGATGTCAGCTGGG No data
1055503473_1055503481 -2 Left 1055503473 9:76924936-76924958 CCATTTGCACACCACCCCAGGGG No data
Right 1055503481 9:76924957-76924979 GGAGGCAGAAGATGTCAGCTGGG No data
1055503470_1055503481 15 Left 1055503470 9:76924919-76924941 CCTGACTGATACAGTCTCCATTT No data
Right 1055503481 9:76924957-76924979 GGAGGCAGAAGATGTCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055503481 Original CRISPR GGAGGCAGAAGATGTCAGCT GGG Intergenic
No off target data available for this crispr