ID: 1055504069

View in Genome Browser
Species Human (GRCh38)
Location 9:76930447-76930469
Sequence GTATGCACAAGGGTAGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055504069_1055504077 29 Left 1055504069 9:76930447-76930469 CCTTTCTCTACCCTTGTGCATAC No data
Right 1055504077 9:76930499-76930521 GTGCTGTGGGTGTATTGGTGTGG No data
1055504069_1055504072 -9 Left 1055504069 9:76930447-76930469 CCTTTCTCTACCCTTGTGCATAC No data
Right 1055504072 9:76930461-76930483 TGTGCATACTCTAGAACAGTAGG No data
1055504069_1055504073 15 Left 1055504069 9:76930447-76930469 CCTTTCTCTACCCTTGTGCATAC No data
Right 1055504073 9:76930485-76930507 ACATAGACATTCCAGTGCTGTGG No data
1055504069_1055504075 24 Left 1055504069 9:76930447-76930469 CCTTTCTCTACCCTTGTGCATAC No data
Right 1055504075 9:76930494-76930516 TTCCAGTGCTGTGGGTGTATTGG No data
1055504069_1055504074 16 Left 1055504069 9:76930447-76930469 CCTTTCTCTACCCTTGTGCATAC No data
Right 1055504074 9:76930486-76930508 CATAGACATTCCAGTGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055504069 Original CRISPR GTATGCACAAGGGTAGAGAA AGG (reversed) Intergenic
No off target data available for this crispr