ID: 1055506912

View in Genome Browser
Species Human (GRCh38)
Location 9:76957360-76957382
Sequence TATCCACAGCAGCTCAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055506911_1055506912 4 Left 1055506911 9:76957333-76957355 CCAAAAGGTTGATATCTCTTTTT No data
Right 1055506912 9:76957360-76957382 TATCCACAGCAGCTCAAAACAGG No data
1055506910_1055506912 5 Left 1055506910 9:76957332-76957354 CCCAAAAGGTTGATATCTCTTTT No data
Right 1055506912 9:76957360-76957382 TATCCACAGCAGCTCAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055506912 Original CRISPR TATCCACAGCAGCTCAAAAC AGG Intergenic
No off target data available for this crispr