ID: 1055508152

View in Genome Browser
Species Human (GRCh38)
Location 9:76969020-76969042
Sequence CAGAGTAAACAAAGGTATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055508152_1055508154 -9 Left 1055508152 9:76969020-76969042 CCTCAATACCTTTGTTTACTCTG No data
Right 1055508154 9:76969034-76969056 TTTACTCTGTTCCCCTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055508152 Original CRISPR CAGAGTAAACAAAGGTATTG AGG (reversed) Intergenic
No off target data available for this crispr