ID: 1055510563

View in Genome Browser
Species Human (GRCh38)
Location 9:76992076-76992098
Sequence CACTGGGTCTGGCGGTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055510563_1055510577 15 Left 1055510563 9:76992076-76992098 CCTTCACACCGCCAGACCCAGTG No data
Right 1055510577 9:76992114-76992136 TTTGACTCCCAGGATGGGGGTGG 0: 1
1: 0
2: 2
3: 16
4: 245
1055510563_1055510575 11 Left 1055510563 9:76992076-76992098 CCTTCACACCGCCAGACCCAGTG No data
Right 1055510575 9:76992110-76992132 GGACTTTGACTCCCAGGATGGGG 0: 1
1: 0
2: 0
3: 17
4: 200
1055510563_1055510573 9 Left 1055510563 9:76992076-76992098 CCTTCACACCGCCAGACCCAGTG No data
Right 1055510573 9:76992108-76992130 AGGGACTTTGACTCCCAGGATGG 0: 1
1: 0
2: 1
3: 28
4: 266
1055510563_1055510572 5 Left 1055510563 9:76992076-76992098 CCTTCACACCGCCAGACCCAGTG No data
Right 1055510572 9:76992104-76992126 GGCGAGGGACTTTGACTCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 95
1055510563_1055510569 -10 Left 1055510563 9:76992076-76992098 CCTTCACACCGCCAGACCCAGTG No data
Right 1055510569 9:76992089-76992111 AGACCCAGTGGCAGCGGCGAGGG 0: 1
1: 0
2: 0
3: 9
4: 143
1055510563_1055510574 10 Left 1055510563 9:76992076-76992098 CCTTCACACCGCCAGACCCAGTG No data
Right 1055510574 9:76992109-76992131 GGGACTTTGACTCCCAGGATGGG 0: 1
1: 0
2: 0
3: 5
4: 155
1055510563_1055510579 17 Left 1055510563 9:76992076-76992098 CCTTCACACCGCCAGACCCAGTG No data
Right 1055510579 9:76992116-76992138 TGACTCCCAGGATGGGGGTGGGG 0: 1
1: 0
2: 6
3: 56
4: 431
1055510563_1055510576 12 Left 1055510563 9:76992076-76992098 CCTTCACACCGCCAGACCCAGTG No data
Right 1055510576 9:76992111-76992133 GACTTTGACTCCCAGGATGGGGG 0: 1
1: 0
2: 0
3: 25
4: 357
1055510563_1055510578 16 Left 1055510563 9:76992076-76992098 CCTTCACACCGCCAGACCCAGTG No data
Right 1055510578 9:76992115-76992137 TTGACTCCCAGGATGGGGGTGGG 0: 1
1: 0
2: 2
3: 22
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055510563 Original CRISPR CACTGGGTCTGGCGGTGTGA AGG (reversed) Intergenic
No off target data available for this crispr