ID: 1055511202

View in Genome Browser
Species Human (GRCh38)
Location 9:76997401-76997423
Sequence TAGGGTAGTTCTGCCTGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055511202_1055511209 18 Left 1055511202 9:76997401-76997423 CCAGAACAGGCAGAACTACCCTA No data
Right 1055511209 9:76997442-76997464 CACTGATTGCCTGGGACAGGAGG No data
1055511202_1055511205 9 Left 1055511202 9:76997401-76997423 CCAGAACAGGCAGAACTACCCTA No data
Right 1055511205 9:76997433-76997455 AAATCACCTCACTGATTGCCTGG No data
1055511202_1055511211 30 Left 1055511202 9:76997401-76997423 CCAGAACAGGCAGAACTACCCTA No data
Right 1055511211 9:76997454-76997476 GGGACAGGAGGAACTTCCAGTGG No data
1055511202_1055511206 10 Left 1055511202 9:76997401-76997423 CCAGAACAGGCAGAACTACCCTA No data
Right 1055511206 9:76997434-76997456 AATCACCTCACTGATTGCCTGGG No data
1055511202_1055511208 15 Left 1055511202 9:76997401-76997423 CCAGAACAGGCAGAACTACCCTA No data
Right 1055511208 9:76997439-76997461 CCTCACTGATTGCCTGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055511202 Original CRISPR TAGGGTAGTTCTGCCTGTTC TGG (reversed) Intergenic
No off target data available for this crispr