ID: 1055511345

View in Genome Browser
Species Human (GRCh38)
Location 9:76998634-76998656
Sequence CTCCAAGTCACAGTTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055511345_1055511349 29 Left 1055511345 9:76998634-76998656 CCAGACACAACTGTGACTTGGAG No data
Right 1055511349 9:76998686-76998708 GTGACAGTGGCTACACTGCACGG No data
1055511345_1055511348 16 Left 1055511345 9:76998634-76998656 CCAGACACAACTGTGACTTGGAG No data
Right 1055511348 9:76998673-76998695 AACTTTCTCTCATGTGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055511345 Original CRISPR CTCCAAGTCACAGTTGTGTC TGG (reversed) Intergenic
No off target data available for this crispr