ID: 1055514329

View in Genome Browser
Species Human (GRCh38)
Location 9:77020833-77020855
Sequence GCCATCCACCGTGTGCTCCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 58}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055514323_1055514329 4 Left 1055514323 9:77020806-77020828 CCCCGCGGCTTCGCAGCAGCCTC 0: 1
1: 0
2: 0
3: 16
4: 147
Right 1055514329 9:77020833-77020855 GCCATCCACCGTGTGCTCCGCGG 0: 1
1: 0
2: 2
3: 4
4: 58
1055514324_1055514329 3 Left 1055514324 9:77020807-77020829 CCCGCGGCTTCGCAGCAGCCTCC 0: 1
1: 0
2: 2
3: 21
4: 245
Right 1055514329 9:77020833-77020855 GCCATCCACCGTGTGCTCCGCGG 0: 1
1: 0
2: 2
3: 4
4: 58
1055514320_1055514329 29 Left 1055514320 9:77020781-77020803 CCGCGCTGCAGCCGGGGCTCACT 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1055514329 9:77020833-77020855 GCCATCCACCGTGTGCTCCGCGG 0: 1
1: 0
2: 2
3: 4
4: 58
1055514325_1055514329 2 Left 1055514325 9:77020808-77020830 CCGCGGCTTCGCAGCAGCCTCCG 0: 1
1: 0
2: 1
3: 14
4: 167
Right 1055514329 9:77020833-77020855 GCCATCCACCGTGTGCTCCGCGG 0: 1
1: 0
2: 2
3: 4
4: 58
1055514322_1055514329 18 Left 1055514322 9:77020792-77020814 CCGGGGCTCACTGTCCCCGCGGC 0: 1
1: 0
2: 2
3: 27
4: 210
Right 1055514329 9:77020833-77020855 GCCATCCACCGTGTGCTCCGCGG 0: 1
1: 0
2: 2
3: 4
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055514329 Original CRISPR GCCATCCACCGTGTGCTCCG CGG Exonic
900098687 1:951737-951759 GCCACCCAGCGTGTGTTCTGGGG - Intronic
900521096 1:3105924-3105946 GCCATCCTTAGTGTGCCCCGGGG + Intronic
902409701 1:16205731-16205753 GCCATCCACGGGGTCCTCAGGGG + Intronic
912058343 1:105632801-105632823 GACATGCCCTGTGTGCTCCGGGG - Intergenic
922729290 1:227941617-227941639 GCCATCTCCCCTGTGCTCCCAGG - Intronic
923521174 1:234735997-234736019 ACCATCCATCGAGTGCTCCCGGG - Intergenic
1062857189 10:785192-785214 CCCATACAGCGTGTGCTGCGGGG + Intergenic
1070830781 10:79416973-79416995 GCCATCCACAGTGTCTGCCGTGG - Intronic
1071529004 10:86374937-86374959 GCACTCCACCGTGTCCTCTGAGG + Intergenic
1076687255 10:132203768-132203790 GAGATCCACGGTGTGCCCCGTGG + Exonic
1077049890 11:561814-561836 GGCATCCAGCGTGTGGTCTGTGG + Exonic
1084791329 11:71477018-71477040 GCCCTCCACCAGGTCCTCCGTGG + Intronic
1085219683 11:74863097-74863119 GCCATCCACTGTGTGCAGCAGGG + Intronic
1096180506 12:49548052-49548074 GCAATCCAGCCTCTGCTCCGTGG + Intronic
1104147017 12:126044366-126044388 GCCCTACACCGTGGGCTCCAAGG - Intergenic
1104985777 12:132596218-132596240 GCCGTCCAACGTGTGCCCCTCGG - Intergenic
1113953050 13:114082475-114082497 GCAAACCTCCCTGTGCTCCGAGG + Intronic
1123039477 14:105484523-105484545 CCCATCTACCCTGTGCTCTGGGG - Intergenic
1132986491 16:2770173-2770195 ACCATCCACCGAGTGCCCAGTGG - Intronic
1133452797 16:5917682-5917704 GCCATCCACCGTTTCTTCCCTGG + Intergenic
1137706627 16:50539935-50539957 GCCAGCCACAGTGTGATGCGAGG + Intergenic
1137983102 16:53086304-53086326 GCTTTCCACCGTGTGCTCAATGG + Intronic
1140469463 16:75206157-75206179 GCCATCCACCCTGTGCTCAGCGG - Exonic
1140472321 16:75222782-75222804 GCCATCCACCCTGTGCTCAGCGG + Exonic
1143925473 17:10365543-10365565 GCCATCCTCAGTGTGGTCCCTGG - Intronic
1144329794 17:14213168-14213190 CCCATCCACCTTCTGCTCTGTGG - Intergenic
1145886347 17:28384834-28384856 GCCATCCACCTGCTGCTCCTGGG - Exonic
1149988743 17:61368405-61368427 GCCCTCCTCCGTGTGCTCCATGG - Exonic
1151195148 17:72425973-72425995 GGCACCTACCGTGTGCTCCTTGG + Intergenic
1153981576 18:10315054-10315076 GACATCCTCCGTGTGCACTGAGG + Intergenic
1159563791 18:70024943-70024965 GCCATCCACAGGGTTCTCCTTGG - Intronic
1160839677 19:1140544-1140566 GGCATCCACCGTGGGCTGCGGGG - Intronic
1163627159 19:18396873-18396895 GTCGTGCACCGTGTCCTCCGCGG - Exonic
1165060918 19:33204882-33204904 GGCATGCACGGTGTGCTCCGTGG - Intronic
1166367000 19:42282926-42282948 GCCAGCCATGGTGTGCTCTGTGG + Intronic
1167501671 19:49851645-49851667 GCGAACCACCGGGTGCTCCACGG - Intronic
1168115109 19:54218011-54218033 CCCATCCACAGTGAGCTCCCTGG + Intronic
1168120802 19:54251703-54251725 CCCATCCACAGTGAGCTCCCTGG + Intronic
1168177606 19:54635938-54635960 CCCATCCACAGTGAGCTCCCTGG - Intronic
1168181883 19:54667078-54667100 CCCATCCACAGTGAGCTCCCTGG - Intronic
925348580 2:3186785-3186807 GCCAGCCACCGGGTGCACAGTGG + Intergenic
927446499 2:23166650-23166672 GCCATCCACAGTGTGTTACCTGG + Intergenic
928799354 2:35068054-35068076 GCCAGCCACCATGTGCCCAGAGG - Intergenic
942135121 2:172917657-172917679 GCCATGAAACGTGTTCTCCGGGG - Intronic
1175960133 20:62631692-62631714 GCCTTCCACCAAGTGCTCAGGGG + Intergenic
1179792359 21:43762897-43762919 GCCCTCCCCTGTGTGCTCTGTGG - Intergenic
1180614108 22:17116809-17116831 GTCAACCACTGTGTGCTCAGAGG - Exonic
962344775 3:134610966-134610988 GACATCCACCGCCTGCCCCGGGG - Intronic
968623603 4:1615666-1615688 GCCATCCCCTGTGTGCGCCCAGG - Intergenic
985973197 5:3393434-3393456 GCCCCCCACCGTGTCCTCGGGGG + Intergenic
992989834 5:82273142-82273164 GCCATCCAAAGAGTGCTCCTGGG - Intronic
1019648288 7:2142535-2142557 GCCCTTCACCGTGGGCTCAGTGG - Intronic
1023306898 7:38839976-38839998 GCCATCCACTCAGTGCTCCGGGG + Intronic
1023832071 7:44045082-44045104 GCCACCCACTGTGGGCTTCGCGG + Intronic
1024748605 7:52436350-52436372 GTCATCCACAGTGGGCTCAGAGG + Intergenic
1039574295 8:38611204-38611226 GCCTTCCACCCTGGGCTCCCCGG - Intergenic
1044254148 8:90040082-90040104 GCCATCCTCTCTGTGCTCAGAGG - Intronic
1049573807 8:143381480-143381502 TCCATCCAACCTGTGCACCGAGG - Intronic
1049844165 8:144792110-144792132 GCCATGGGCCGTGTGATCCGTGG - Exonic
1055514329 9:77020833-77020855 GCCATCCACCGTGTGCTCCGCGG + Exonic
1062397120 9:136357000-136357022 GCCGTCCACTGTGTGGTCCCTGG - Intronic
1190708413 X:53048936-53048958 GCCATGGCCCGTGTGCTCCCAGG + Intergenic
1195212382 X:102661866-102661888 GACATCCACCTTTTGCTCCAAGG + Intergenic
1196197020 X:112847233-112847255 GCCATCCTTGGTGTGCTCTGTGG + Intergenic
1198025977 X:132707586-132707608 ACAATCCACCCTGTGCTCCCTGG - Intronic