ID: 1055514728

View in Genome Browser
Species Human (GRCh38)
Location 9:77023210-77023232
Sequence GCGGCGCCTCCGCTGGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055514720_1055514728 -3 Left 1055514720 9:77023190-77023212 CCAGGAGGCCCCGGCAGGGTGCG No data
Right 1055514728 9:77023210-77023232 GCGGCGCCTCCGCTGGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055514728 Original CRISPR GCGGCGCCTCCGCTGGGGCC TGG Intergenic