ID: 1055526459

View in Genome Browser
Species Human (GRCh38)
Location 9:77138586-77138608
Sequence GGCCACAACAAAATAACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055526455_1055526459 2 Left 1055526455 9:77138561-77138583 CCAAGCTAAAGCTCTTCCTCATA No data
Right 1055526459 9:77138586-77138608 GGCCACAACAAAATAACACAGGG No data
1055526454_1055526459 13 Left 1055526454 9:77138550-77138572 CCAACTGGTGGCCAAGCTAAAGC No data
Right 1055526459 9:77138586-77138608 GGCCACAACAAAATAACACAGGG No data
1055526453_1055526459 20 Left 1055526453 9:77138543-77138565 CCAAATACCAACTGGTGGCCAAG No data
Right 1055526459 9:77138586-77138608 GGCCACAACAAAATAACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055526459 Original CRISPR GGCCACAACAAAATAACACA GGG Intergenic
No off target data available for this crispr