ID: 1055530355

View in Genome Browser
Species Human (GRCh38)
Location 9:77177575-77177597
Sequence TTCAGCTGCGGCGCCCCCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055530355_1055530371 25 Left 1055530355 9:77177575-77177597 CCAGCGGGGGCGCCGCAGCTGAA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1055530371 9:77177623-77177645 TTACCTCGAGGGAGGGGCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 92
1055530355_1055530372 26 Left 1055530355 9:77177575-77177597 CCAGCGGGGGCGCCGCAGCTGAA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1055530372 9:77177624-77177646 TACCTCGAGGGAGGGGCGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 165
1055530355_1055530365 14 Left 1055530355 9:77177575-77177597 CCAGCGGGGGCGCCGCAGCTGAA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1055530365 9:77177612-77177634 GGTGAACCGAATTACCTCGAGGG 0: 1
1: 0
2: 0
3: 0
4: 9
1055530355_1055530366 17 Left 1055530355 9:77177575-77177597 CCAGCGGGGGCGCCGCAGCTGAA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1055530366 9:77177615-77177637 GAACCGAATTACCTCGAGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 16
1055530355_1055530367 18 Left 1055530355 9:77177575-77177597 CCAGCGGGGGCGCCGCAGCTGAA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1055530367 9:77177616-77177638 AACCGAATTACCTCGAGGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1055530355_1055530368 19 Left 1055530355 9:77177575-77177597 CCAGCGGGGGCGCCGCAGCTGAA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1055530368 9:77177617-77177639 ACCGAATTACCTCGAGGGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 19
1055530355_1055530370 24 Left 1055530355 9:77177575-77177597 CCAGCGGGGGCGCCGCAGCTGAA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1055530370 9:77177622-77177644 ATTACCTCGAGGGAGGGGCGTGG 0: 1
1: 0
2: 0
3: 3
4: 120
1055530355_1055530364 13 Left 1055530355 9:77177575-77177597 CCAGCGGGGGCGCCGCAGCTGAA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1055530364 9:77177611-77177633 CGGTGAACCGAATTACCTCGAGG 0: 1
1: 0
2: 0
3: 0
4: 13
1055530355_1055530374 30 Left 1055530355 9:77177575-77177597 CCAGCGGGGGCGCCGCAGCTGAA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1055530374 9:77177628-77177650 TCGAGGGAGGGGCGTGGGGAAGG 0: 1
1: 0
2: 5
3: 68
4: 879
1055530355_1055530358 -7 Left 1055530355 9:77177575-77177597 CCAGCGGGGGCGCCGCAGCTGAA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1055530358 9:77177591-77177613 AGCTGAAGCCGCCCCGGAGCCGG 0: 1
1: 0
2: 4
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055530355 Original CRISPR TTCAGCTGCGGCGCCCCCGC TGG (reversed) Exonic
905414327 1:37794188-37794210 TGCAGGCGCGGCGCCGCCGCCGG - Exonic
905920362 1:41715120-41715142 TTCAGCTGCGGAACCCCAGCCGG + Intronic
908355634 1:63323197-63323219 CGCAGCTCCGGCGGCCCCGCGGG - Exonic
920367760 1:205457039-205457061 AAAAGCTGCGGCGCCGCCGCCGG + Intergenic
1065727261 10:28677865-28677887 CACGGCCGCGGCGCCCCCGCCGG - Exonic
1069819274 10:71217545-71217567 CTCAGCCGCTGCGCCCCCGCGGG + Intronic
1070773586 10:79097040-79097062 TTCAGCTGCTCTGCCCCTGCCGG - Intronic
1076217790 10:128710373-128710395 TGCAGCTCCGGAGGCCCCGCCGG + Intergenic
1076858417 10:133128424-133128446 TGCAGCTGCGGCGCCACCCAGGG + Exonic
1076906187 10:133362629-133362651 TTCTGCTGAGGAGCCCCCGCTGG - Exonic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1078057341 11:8019074-8019096 TGCCGCAGCCGCGCCCCCGCGGG + Intergenic
1083168391 11:60906276-60906298 GTCCGCTGCGGCGCCCGGGCCGG - Intronic
1092431676 12:8414821-8414843 TTCTGCTGCGCAGCCTCCGCAGG + Intergenic
1092434627 12:8437444-8437466 TTCTGCTGCGCAGCCTCCGCAGG + Intergenic
1092508030 12:9124597-9124619 TGCAGCTGCGGCACCCTCACAGG + Intergenic
1094025898 12:25959119-25959141 CGCAACTGCGCCGCCCCCGCAGG - Exonic
1102157480 12:110742728-110742750 TCCCGCAGCGGCGCCGCCGCCGG + Exonic
1106340281 13:28820390-28820412 TCCACCTGCGCCGCCGCCGCCGG + Exonic
1114209282 14:20601657-20601679 TTGAGCTGCCGTGTCCCCGCGGG - Intronic
1114485189 14:23057729-23057751 TACAGATGCGGCGCCCCTCCCGG + Intergenic
1117039645 14:51757922-51757944 TTCTGCTGCGCAGCCTCCGCAGG - Intergenic
1117041293 14:51771835-51771857 TTCTGCTGCGCAGCCTCCGCAGG + Intergenic
1122780936 14:104143223-104143245 TTCAGCTGCGTGGCACCAGCAGG - Intronic
1122947705 14:105020787-105020809 CTCAGCAGCGGCCACCCCGCGGG + Intronic
1127117395 15:55742441-55742463 TGCAGCCGCGGCGGCCCCGGCGG + Intronic
1132292492 15:100713329-100713351 TTCAGCTGTGGAGCCCGGGCAGG + Intergenic
1132365218 15:101251889-101251911 TGCAGCTGCGGCGGCGGCGCCGG - Exonic
1132621809 16:871341-871363 CTCAGCTGCGGCGTCTCCACAGG - Exonic
1133820595 16:9232780-9232802 TTCAGCTCCAGGGCCCCCACTGG + Intergenic
1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG + Exonic
1138874711 16:60936018-60936040 TTCATCTGCGTCGCTCACGCTGG - Intergenic
1141079232 16:81036021-81036043 GGCTGCTGCGTCGCCCCCGCGGG - Exonic
1160696859 19:489094-489116 TTCAGCTGCGGGGGCCGCGCGGG + Intergenic
1163632918 19:18426258-18426280 CTCAGCTGCGCCGCCCTCTCTGG - Intronic
1165491865 19:36128179-36128201 GTCAGCTTCGGCGCCTCCCCCGG - Intergenic
1166788003 19:45380787-45380809 TTCAGCTGCGTCGCCCAGGCTGG - Intronic
940870323 2:158854510-158854532 TTCTGCTGCGCAGCCTCCGCAGG - Intronic
1169483513 20:6006488-6006510 TTCGGCAGCGGCGCCCGCTCCGG - Exonic
1172409342 20:34710113-34710135 TCCAGCAGCGCCGCCCGCGCTGG - Exonic
1175562319 20:59940467-59940489 TTCCTCTCCGGCGCCCGCGCGGG - Intronic
1176292604 21:5054135-5054157 TTCAGCTGCAGCCCTCCGGCAGG - Intergenic
1179864656 21:44209515-44209537 TTCAGCTGCAGCCCTCCGGCAGG + Intergenic
1180790034 22:18570860-18570882 TCCAGGTGCAGGGCCCCCGCCGG - Intergenic
1181231705 22:21424455-21424477 TCCAGGTGCAGGGCCCCCGCCGG + Intronic
1181246946 22:21510413-21510435 TCCAGGTGCAGGGCCCCCGCCGG - Intergenic
1182144766 22:27990651-27990673 ACGGGCTGCGGCGCCCCCGCGGG - Intronic
1183662482 22:39229837-39229859 TTCACCTGTGCCACCCCCGCCGG - Intronic
1183744968 22:39686819-39686841 CACAGCTGGGACGCCCCCGCAGG - Exonic
1184651234 22:45920310-45920332 TGCAGCTGCGGCCCCACCGGTGG - Intergenic
1185037964 22:48489570-48489592 TGAAGCCGCGGCGCCCGCGCGGG - Exonic
1185234748 22:49705303-49705325 TCCAGCTGTGGCGGCCCCCCAGG + Intergenic
1185315361 22:50176707-50176729 GTCAGCTGCGGGGCACCTGCAGG - Intronic
956326610 3:68059916-68059938 GGCAGCTGGGGAGCCCCCGCAGG + Intronic
956677939 3:71753430-71753452 TCCGGCGGCGGCGCCCGCGCTGG - Intronic
961275814 3:125725442-125725464 TTCTGCTGCGCAGCCTCCGCAGG - Intergenic
961278732 3:125748037-125748059 TTCTGCTGCGCAGCCTCCGCAGG - Intergenic
961405875 3:126679281-126679303 TTCAGCTGCGTGGGCCCGGCAGG + Intergenic
969786327 4:9460181-9460203 TTCTGCTGCGTAGCCTCCGCAGG - Intergenic
969794242 4:9513830-9513852 TTCTGCTGCGCAGCCTCCGCAGG - Intergenic
974047268 4:56908349-56908371 TCCGGCGGCGGCGGCCCCGCCGG + Intronic
982403298 4:154992460-154992482 GTAAGCCACGGCGCCCCCGCAGG + Intergenic
996405618 5:123099745-123099767 TGCGGCCGCCGCGCCCCCGCCGG + Exonic
999309930 5:150545387-150545409 TTCAGAAGTGGCGCCCCGGCGGG + Exonic
1016272149 6:142301830-142301852 CTCAGGTGCGGCGGCCCCGGCGG - Intergenic
1019472875 7:1230424-1230446 CTCGGCTGCGGCGGCGCCGCGGG - Intergenic
1019501953 7:1369085-1369107 GACAGCTGCGGCGCCCCTGGGGG - Intergenic
1019658783 7:2212097-2212119 TTCAGTCGCGGTGCCCCTGCAGG - Intronic
1021451291 7:20785482-20785504 TTCAGCTGCGGCGGCTCGCCTGG - Exonic
1023937360 7:44749133-44749155 TTCCGCTGCGGCGCCACGGTAGG + Intronic
1024025595 7:45407785-45407807 TTCAGCAGGGGCGCCGCCGATGG + Intergenic
1026595792 7:71733177-71733199 TGCAGGCGCAGCGCCCCCGCTGG + Intergenic
1026805098 7:73424364-73424386 TTCAGCAGCGGCGGCGCCTCCGG + Intergenic
1036819462 8:11928609-11928631 TTCTGCTGCGCAGCCTCCGCAGG + Intergenic
1036832632 8:12033658-12033680 TTCTGCTGCGCAGCCTCCGCAGG + Intergenic
1036902798 8:12684181-12684203 TTCTGCTGCGCAGCCTCCGCAGG + Intergenic
1036905223 8:12703093-12703115 TTCTGCTGCGCAGCCTCCGCAGG + Intergenic
1037807467 8:22066644-22066666 TTAGGCTGCGGGGCCTCCGCGGG - Intronic
1041910720 8:63085978-63086000 TTGAGCTGCGGCCCCGCCGAGGG + Exonic
1049746466 8:144265273-144265295 TGCAGCTCCGGCGCCTCCGAGGG - Intronic
1055530355 9:77177575-77177597 TTCAGCTGCGGCGCCCCCGCTGG - Exonic
1061592383 9:131606221-131606243 TTCAGCAGCAGAGCCCCAGCCGG - Intronic
1062495688 9:136830514-136830536 TTCAGCTCGGGCGCACACGCTGG + Intronic
1203561293 Un_KI270744v1:60428-60450 TGCAGCTGCGGCTCCCATGCCGG + Intergenic
1196819644 X:119692765-119692787 TGCAGCTGCGGCCCCACGGCTGG - Intronic