ID: 1055536863

View in Genome Browser
Species Human (GRCh38)
Location 9:77256526-77256548
Sequence GTAGATTAATAAGGAAACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 653
Summary {0: 1, 1: 2, 2: 13, 3: 108, 4: 529}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055536863 Original CRISPR GTAGATTAATAAGGAAACAG GGG (reversed) Intronic
903278216 1:22234701-22234723 CTAGATTATTGGGGAAACAGTGG + Intergenic
905769532 1:40628626-40628648 GTTGATTCATAAGGAAACCAAGG - Intronic
907177370 1:52537578-52537600 GAAAATCAAAAAGGAAACAGAGG + Intronic
907775929 1:57514829-57514851 TTTGATAAATGAGGAAACAGAGG - Intronic
908057888 1:60311339-60311361 GAAGATAAGTAAGGAAATAGAGG + Intergenic
909175973 1:72359564-72359586 GGAGATCAGTAAGGAAATAGAGG + Intergenic
909485732 1:76171542-76171564 CTAGACTAATAAGGAAGAAGAGG + Intronic
909819059 1:80036166-80036188 GAAGATAAGTAAGGAAATAGAGG - Intergenic
910801420 1:91151096-91151118 GAAAATCAATAAGGAAACAGTGG - Intergenic
911782185 1:101895223-101895245 GTAAATAAATAAGCAAATAGAGG - Intronic
912065744 1:105739859-105739881 GCAGTTAAATAAGCAAACAGAGG - Intergenic
912169208 1:107077620-107077642 GTAGAATAAAAAGGAAACAAAGG - Intergenic
912250646 1:108008999-108009021 ATGGATTAATAAAGTAACAGTGG - Intergenic
912349980 1:109003189-109003211 GAAGATCAATAAGGATATAGAGG - Intronic
912894040 1:113566410-113566432 AAAGATCAATGAGGAAACAGAGG + Intronic
915045963 1:153017030-153017052 GAAGATAAGTAAGGAAATAGAGG - Intergenic
915777370 1:158504864-158504886 GGATATCAATAAAGAAACAGTGG - Intergenic
915863481 1:159472905-159472927 GGAGATTATTAAGGACACATGGG + Intergenic
915967109 1:160319485-160319507 GTAAATCAACAAAGAAACAGTGG + Intronic
915990211 1:160507489-160507511 GAAGATCAATAAGGAAATAGAGG + Intronic
916329556 1:163599494-163599516 GAAGATTGATGAGGAAAGAGTGG + Intergenic
916392987 1:164352783-164352805 AAAAATCAATAAGGAAACAGAGG + Intergenic
917004048 1:170392238-170392260 CAAGATAAGTAAGGAAACAGAGG - Intergenic
917246473 1:173007132-173007154 GAAAATCAATAAGGAAACATTGG - Intergenic
917251611 1:173068783-173068805 GAAGATTAATAAGAAAATAGAGG + Intergenic
918231750 1:182539797-182539819 GAAGTTTACTAAGGAAACTGAGG - Intronic
918272462 1:182915536-182915558 GAAGAACAATAAGGAAATAGAGG + Intronic
919243437 1:194945385-194945407 GTGAATAAATAAGGAAACTGTGG + Intergenic
919245668 1:194980070-194980092 CTAGATTAATAAAGAAAAAAAGG - Intergenic
919303528 1:195800736-195800758 GTAAATCAATAAACAAACAGTGG + Intergenic
920384172 1:205556314-205556336 AAAGATTAATTAGGAAAAAGTGG + Intergenic
921910303 1:220541458-220541480 GAAGATCAACAAGGAAACAGAGG - Intronic
922708724 1:227809580-227809602 GAACATTAATAAGGAAACACTGG + Intergenic
922865366 1:228856140-228856162 GAAGATAAGCAAGGAAACAGAGG - Intergenic
924303938 1:242667677-242667699 GTAGGTCAATATGGAAAAAGTGG - Intergenic
924477927 1:244397631-244397653 GGACATTAATTAGGAAATAGTGG - Intergenic
924478128 1:244399581-244399603 GAAGATTAATAAGGAAATAGAGG - Intergenic
1062864392 10:838877-838899 GTAGATGGATAAGCAAACTGTGG + Intronic
1062900358 10:1140274-1140296 CCAGATTAATCAGGAAACAAAGG - Intergenic
1063090862 10:2865293-2865315 TTATATTCATAAGGAAACCGAGG - Intergenic
1063320532 10:5047732-5047754 GTGGATTAAAAAGCTAACAGTGG - Intronic
1065056476 10:21848584-21848606 GAAGATAAATAGGGAACCAGAGG + Intronic
1065456481 10:25911307-25911329 GGAAATTTATAAGGAAAAAGAGG - Intergenic
1065977419 10:30854582-30854604 GAAAATTAAAAAAGAAACAGAGG + Intronic
1066034277 10:31466220-31466242 GAAAATCAATAAAGAAACAGTGG + Intronic
1066111188 10:32198569-32198591 GAAGATCAATAATGAAATAGAGG - Intergenic
1066151745 10:32629038-32629060 GAACATTAATAACGAAACACTGG - Intronic
1066183924 10:32990369-32990391 ATACACTAATAAGAAAACAGAGG + Intronic
1066195048 10:33090881-33090903 GTAGATGAAAAAGGATACAGTGG + Intergenic
1066247910 10:33602013-33602035 GAAAATCAATAAGGAAACAGTGG + Intergenic
1068513481 10:57995996-57996018 ATAAATTAATAAGAAAGCAGTGG - Intergenic
1068515918 10:58025294-58025316 GGAAGTAAATAAGGAAACAGAGG - Intergenic
1068648382 10:59494498-59494520 GAAGATTAACAAAGAAACATTGG - Intergenic
1069328506 10:67261533-67261555 GCAGAGTAAGGAGGAAACAGAGG + Intronic
1070316279 10:75316172-75316194 GAAAATCAATAAGGAAACATTGG + Intergenic
1070427670 10:76305020-76305042 GAAGATTCACAAGGAAACTGGGG - Intronic
1071092865 10:81940307-81940329 GAAGATAAATAAGGAAACAAAGG - Intronic
1071420362 10:85490746-85490768 GAAGATCAACAAGGAAACAGAGG + Intergenic
1071689193 10:87797593-87797615 ATGGAATAATATGGAAACAGAGG - Intronic
1071744197 10:88397066-88397088 GAAGATCAATAAAGAAATAGAGG + Intronic
1072020827 10:91398601-91398623 GAAAATCACTAAGGAAACAGAGG + Intergenic
1072071021 10:91917577-91917599 GAAAATTAATAAGGAAATACTGG - Intergenic
1072523477 10:96250649-96250671 GCAGAGTAATAGGGAACCAGGGG + Intronic
1072879328 10:99209091-99209113 GAAAATTAATAAGGAAAAACTGG + Intronic
1073864423 10:107785667-107785689 GAAAATCAATAAGGAAATAGAGG - Intergenic
1073998542 10:109343523-109343545 GTAGAATCATAAGGAAAGACAGG + Intergenic
1074466375 10:113685378-113685400 GAAAATCAATTAGGAAACAGTGG - Intronic
1074651539 10:115529152-115529174 GAAGATAATAAAGGAAACAGAGG - Intronic
1074759058 10:116651806-116651828 CTAGATTAATAAAGAAAAAAGGG - Intergenic
1075578926 10:123602006-123602028 GTAGATTAACAGATAAACAGTGG - Intergenic
1077180750 11:1213258-1213280 ACAGATCAATAAGGAAACAGAGG + Intergenic
1077989753 11:7394564-7394586 CTAGATTAACAAAGAAAAAGAGG - Intronic
1079576758 11:22013267-22013289 GTAGATTGATTAGGAGAGAGCGG + Intergenic
1079699840 11:23531114-23531136 GCAAATTAATAAAGAAAAAGTGG - Intergenic
1079706381 11:23625684-23625706 GAAAATTAATAAGGAAACATTGG - Intergenic
1079833637 11:25303255-25303277 GAAAATTAATAAGAAAACATTGG + Intergenic
1080094293 11:28386662-28386684 GATGCTTAATAAGGAAATAGAGG + Intergenic
1080162553 11:29194807-29194829 GTATATTACTAAGGAAATATGGG - Intergenic
1080377682 11:31733011-31733033 GAAGCTTGGTAAGGAAACAGAGG + Intronic
1080664885 11:34327288-34327310 GAAGATTACTAAGGATAAAGAGG + Intronic
1080754871 11:35187503-35187525 GTATTTTAATTAGAAAACAGTGG - Intronic
1080764674 11:35284423-35284445 ATACATAGATAAGGAAACAGAGG - Intronic
1080955884 11:37094928-37094950 GTAAATTTATAAAGAAAGAGCGG - Intergenic
1081205882 11:40275285-40275307 TTAGAATAATATGCAAACAGGGG + Intronic
1081310549 11:41566198-41566220 GAAGACAAATAAGGAAACAGAGG - Intergenic
1081439273 11:43062609-43062631 GCAGATTAATAGTGAAAAAGAGG - Intergenic
1083291932 11:61695355-61695377 GCAGAATAACAAGGAAACCGGGG - Intronic
1085372506 11:76022326-76022348 GAAGATCAATAAGGAAATCGAGG - Intronic
1086211556 11:84326757-84326779 GAGGATTGATAAGGAAACAGAGG - Intronic
1086355270 11:85991419-85991441 GAACATTAAGAAGGCAACAGTGG + Intronic
1086587595 11:88473329-88473351 TTTGATAAATAAGGAAACTGAGG + Intergenic
1087124642 11:94612090-94612112 GAAAATTAATAAGGAAACATTGG - Intronic
1087757549 11:102071073-102071095 GAAAATTAATAAAGAAACACTGG - Intronic
1087932451 11:103993526-103993548 GTAAATTAATAGGGAGATAGTGG - Intronic
1088703935 11:112443638-112443660 GAAGATCAATAAGGAAATAGAGG - Intergenic
1088845854 11:113666265-113666287 GAAGATCAATAAGGAAATAGTGG - Intergenic
1088947381 11:114528437-114528459 GTGGATTAAAAATGAAGCAGAGG - Intronic
1089004507 11:115079727-115079749 ATAGATTAACAAGAAAACAGAGG - Intergenic
1089203603 11:116740583-116740605 ATAAATAAATAAGGAAACTGTGG + Intergenic
1089222254 11:116883411-116883433 GTAAATCAATAAGAAACCAGGGG + Intronic
1089320978 11:117626555-117626577 CTTTATGAATAAGGAAACAGAGG - Intronic
1089715798 11:120357876-120357898 GAATATTAATAAGGACATAGAGG + Intronic
1090209117 11:124904877-124904899 GAAAATTAAAAAGGAAACATTGG - Intergenic
1090255594 11:125281507-125281529 TTTGATAAATAAGGAAAGAGAGG - Intronic
1090904007 11:131057937-131057959 GTTAATTTATAAGGAAAAAGAGG + Intergenic
1091071989 11:132574797-132574819 GAAGATCAATAAGGAAACCAAGG - Intronic
1091211913 11:133868628-133868650 GGAGATTAATAAGGAAATAGAGG - Intergenic
1091707527 12:2707493-2707515 GAGGATAAATAAGGAAATAGAGG + Intergenic
1091983731 12:4889546-4889568 GTAGATCAATAAGGAAAATAAGG + Intergenic
1092316986 12:7427149-7427171 GAAAATCAATAAGGAAATAGCGG + Intronic
1092745645 12:11669738-11669760 TTATATTAATAAAGAAAAAGAGG - Intronic
1093191834 12:16083733-16083755 GAATAATAATAAGGAATCAGAGG - Intergenic
1093613038 12:21185828-21185850 CTAGATTAACAAGGAAAAAAAGG + Intronic
1093613547 12:21193236-21193258 GAAAATCAATGAGGAAACAGAGG - Intronic
1093676638 12:21948270-21948292 GAAAATCAATAAGGAAACACTGG + Intergenic
1093734313 12:22602706-22602728 AAAAATTAATAAGGAAACACTGG + Intergenic
1094165780 12:27441675-27441697 GAAAATCAACAAGGAAACAGTGG + Intergenic
1094455302 12:30625736-30625758 TTAGAGAAATAAAGAAACAGTGG + Intergenic
1094632571 12:32190697-32190719 GAAAATCAATGAGGAAACAGTGG + Intronic
1095363998 12:41379888-41379910 GAAAATCAATAAGGAAACAGTGG - Intronic
1095400196 12:41805476-41805498 GTGGATTGATAAGGAAAGTGTGG - Intergenic
1095563111 12:43589017-43589039 TCAGATAAATAAGGAGACAGAGG - Intergenic
1096721856 12:53528937-53528959 GTTGATTAAAAAGGAAGCTGGGG + Intronic
1096900445 12:54873616-54873638 AAAGACCAATAAGGAAACAGAGG + Intergenic
1097482069 12:60140850-60140872 TTAGCTTAATATGGACACAGAGG - Intergenic
1097668525 12:62509495-62509517 TAAGACTAATAAGGAAACAAAGG + Intronic
1097933876 12:65223176-65223198 GAAGATCAATAAGGGAGCAGAGG - Intronic
1098413922 12:70211959-70211981 GAATATTGATAAGGAAACAGTGG - Intergenic
1098624527 12:72646924-72646946 GAAGATCAATAAGGAAAGAGAGG + Intronic
1099467084 12:83001051-83001073 GGAGATTTAGAAGGAAAAAGTGG - Intronic
1099511796 12:83547911-83547933 GAAGATTAACAAGGATACCGAGG - Intergenic
1099560152 12:84163233-84163255 GTAGTTTAAAAAGCAAACACCGG - Intergenic
1099830135 12:87832011-87832033 GTAGTTTCAGAAGGAAAAAGAGG + Intergenic
1099890583 12:88584651-88584673 CTTGATAAATAAGGAAACTGAGG + Intergenic
1099960541 12:89392808-89392830 ATAGACTAATAAGGACACAGGGG - Intergenic
1100780135 12:98015900-98015922 GAAAATCAATAAGGAAACAGTGG + Intergenic
1101823498 12:108202381-108202403 GTTGACAGATAAGGAAACAGAGG + Intronic
1101933999 12:109041061-109041083 GTTGACTGATGAGGAAACAGAGG - Intronic
1104016116 12:124963567-124963589 GTAGCAGAATAAAGAAACAGTGG + Intronic
1104575222 12:129960533-129960555 ACAGGTTAATAAGGAAAAAGTGG - Intergenic
1105616453 13:22018533-22018555 GTTGATGAGTAATGAAACAGTGG + Intergenic
1105955638 13:25279877-25279899 GTAGATTAAAAAAGATACAGAGG + Intronic
1105993355 13:25645956-25645978 GAAAATTAATAAGGGAACACTGG - Intronic
1106063306 13:26317402-26317424 GAAGATAAGTAAGGAAACAGAGG + Intronic
1106939090 13:34756708-34756730 GAAGATCAACAAGGAAATAGAGG + Intergenic
1106979686 13:35263382-35263404 GAAAATCAATAAGGAAACATTGG + Intronic
1107245985 13:38294456-38294478 GAAAATTAATAAGAAAACAGTGG + Intergenic
1107334768 13:39343336-39343358 GTATATTAAAAAGAAAACAGAGG + Exonic
1107383757 13:39885594-39885616 GAAGATGAATAAGGAAATGGTGG + Intergenic
1107551883 13:41484334-41484356 GAAAATTAATAAAGAAACATTGG - Intergenic
1107976001 13:45689292-45689314 GGAGATAAAGAAGGAAAGAGAGG - Intergenic
1108556688 13:51600471-51600493 GTGGACTAAGAAAGAAACAGAGG - Intronic
1109030982 13:57187112-57187134 GTAAAATAATAAGCAAACACTGG - Intergenic
1109204891 13:59471067-59471089 GAAGATCAATAAAGAAACACAGG + Intergenic
1109458762 13:62626980-62627002 CTAGAATAAGGAGGAAACAGAGG - Intergenic
1109489850 13:63083085-63083107 GAAGATTAACAAGGAAATAGAGG + Intergenic
1109775522 13:67036270-67036292 GTAGATAAAATATGAAACAGTGG - Intronic
1110012707 13:70357878-70357900 GTGAATTAATAAGGAAAATGTGG - Intergenic
1110169027 13:72478004-72478026 GAAAATCAATAAGGAAACATTGG + Intergenic
1110875342 13:80502767-80502789 GTAGATTTAAATGGAAACATTGG + Intergenic
1111478902 13:88795166-88795188 ATAGATAAAAAAGGAAAAAGAGG + Intergenic
1111599073 13:90448315-90448337 ATAGATTAAGAAGGAAAGAGAGG - Intergenic
1112063473 13:95766267-95766289 ATAGAATTATCAGGAAACAGGGG + Intronic
1113773764 13:112930307-112930329 GTAGATGAATAAACAAACTGTGG + Intronic
1114274138 14:21126414-21126436 GAAAATCAATAAGGAAACATTGG + Intergenic
1114906307 14:27131604-27131626 GTAGAATAAGAAGTCAACAGAGG - Intergenic
1115703049 14:35974355-35974377 CTACTTTCATAAGGAAACAGAGG - Intergenic
1116182548 14:41553647-41553669 GTAGACTAGTAAGGAAAATGTGG + Intergenic
1116210261 14:41930064-41930086 TTTGATAAATGAGGAAACAGAGG - Intergenic
1116253685 14:42520874-42520896 GAAAATTAATAAGGAAATATTGG + Intergenic
1116365974 14:44063781-44063803 GAAAATTAATAAGGAAACAGTGG + Intergenic
1116665849 14:47774348-47774370 GTAAATGAATAAGTAAACTGTGG + Intergenic
1117381886 14:55172680-55172702 GACGATTAATAAGGAGGCAGAGG + Intronic
1118499734 14:66348081-66348103 GAAGATCAGTAAGAAAACAGAGG + Intergenic
1118946890 14:70397318-70397340 GAAAATCAATAAGGAAAGAGAGG - Intronic
1119054555 14:71406001-71406023 GAAGATTAATGAGGAATCTGGGG + Intronic
1120182527 14:81358989-81359011 GAAAAGTAATAAGGAAACATTGG + Intronic
1120982766 14:90305537-90305559 GAAGATGGATAAGTAAACAGAGG + Intronic
1121480430 14:94265331-94265353 GGAGATTAATAAGGACTTAGAGG + Intronic
1122329575 14:100903555-100903577 TTAGATTGATGAGGAAACTGAGG + Intergenic
1122433189 14:101670901-101670923 GAAAATCAATAAGGAAACATTGG + Intergenic
1123726147 15:23103235-23103257 GTACATGAATAAAGAAACTGTGG - Intergenic
1123770917 15:23527631-23527653 ATAGAATAATAAAAAAACAGTGG + Intergenic
1125060720 15:35419889-35419911 GAAAATCAATAAGGAAACATTGG + Intronic
1125066562 15:35493636-35493658 GTTTATTAATATGGAAACTGAGG + Intronic
1125301575 15:38259585-38259607 GTGGATGAATAAGTAAACAAAGG + Intronic
1125305126 15:38303232-38303254 GAAGATTTAGAAGAAAACAGAGG - Intronic
1125388210 15:39161716-39161738 GAGGATTAATAAGGAAATAAAGG - Intergenic
1126286790 15:47022024-47022046 GAAAATCAATAGGGAAACAGTGG + Intergenic
1126521443 15:49599948-49599970 GAAAATTAATATGGAAATAGAGG - Intronic
1126552202 15:49944663-49944685 ACAGATCAATAAGGAAACAGAGG + Intronic
1126743486 15:51801441-51801463 TTAGATAGATAAGGAAACTGAGG - Intronic
1127201005 15:56650784-56650806 GTAGATATACAAGAAAACAGAGG + Intronic
1127530961 15:59843185-59843207 ATTGATTAATAAGGAAACTGAGG - Intergenic
1128668125 15:69553513-69553535 ATAGAATAATAAGGATAGAGGGG - Intergenic
1128804428 15:70519994-70520016 GTAGATTAAAAAGGAAAACAAGG + Intergenic
1130211105 15:81923060-81923082 GAAGATAAATAAGGAAATAGAGG + Intergenic
1131406985 15:92173174-92173196 GTGAATTAATAAAGATACAGAGG - Intergenic
1131452378 15:92554093-92554115 GAAGAACAATAAGAAAACAGAGG + Intergenic
1133673627 16:8048415-8048437 GTATATTAAGAAGGAAAAGGAGG - Intergenic
1134352888 16:13454268-13454290 GTAAATTATTAAGGAAAAAATGG + Intergenic
1135767003 16:25186509-25186531 GAAGATGAATAAGGAAACAGAGG - Intergenic
1135869948 16:26140454-26140476 GAAGATTAAGAAGGAAGAAGAGG + Intergenic
1135891904 16:26365106-26365128 GTAGTTTAAAAAGAAAACAGTGG - Intergenic
1136282174 16:29220403-29220425 GCTGATTTATAAGGAAAGAGGGG - Intergenic
1136646173 16:31618437-31618459 GAAGATGAATAAGGAAACAGAGG + Intergenic
1136659013 16:31738233-31738255 AAAGATCAATAAGGAAACAGAGG - Intronic
1137861926 16:51855515-51855537 GTAGAGAAAAAAGGAAACAAAGG + Intergenic
1138000699 16:53276107-53276129 GTTGAATAATGAGGAAAGAGGGG - Intronic
1138783512 16:59817210-59817232 GAAAATTAATAAGGAAACACTGG + Intergenic
1138867291 16:60837492-60837514 GAAGATAAATAAGCTAACAGTGG + Intergenic
1138972250 16:62159689-62159711 GTAGATAAAAAATGACACAGCGG - Intergenic
1140177266 16:72675245-72675267 GGAGATCAATAAGGAAATGGAGG + Intergenic
1141013690 16:80427345-80427367 GTACACAAATAAGGAACCAGAGG + Intergenic
1141025433 16:80541783-80541805 AAAGATAAATAAGGACACAGTGG + Intronic
1141210079 16:81970954-81970976 CAGGATCAATAAGGAAACAGAGG - Intergenic
1142086545 16:88186322-88186344 GCTGATTTATAAGGAAAGAGGGG - Intergenic
1142914311 17:3123171-3123193 GAAAATCAATAAGGAAACACTGG - Intergenic
1143360699 17:6367346-6367368 CTAGATTAATAAAGAAAAAAAGG + Intergenic
1143439948 17:6962631-6962653 GAAAATAAATAAGGAAACAGTGG + Intronic
1146218995 17:31002198-31002220 GTTGATGCATAAGGAAGCAGAGG + Intergenic
1147112473 17:38273515-38273537 GTATATTAATATAGTAACAGTGG - Intergenic
1147663587 17:42130638-42130660 GTAATTTAAGAAGGACACAGCGG - Intronic
1147755950 17:42767970-42767992 GTACAATTATAAGGTAACAGTGG + Intergenic
1147925950 17:43946026-43946048 TTAGATAAGTAAGGAAACAAGGG - Intergenic
1148199832 17:45742729-45742751 TTATCTTAATAAGGAAACTGAGG - Intergenic
1148417156 17:47515734-47515756 GTATATTAATATAGTAACAGTGG + Intergenic
1149092409 17:52799921-52799943 GAAGATCAATAAGGAAACAGAGG + Intergenic
1149128158 17:53260593-53260615 GGAGATTTATAAAGAAAAAGAGG - Intergenic
1149237948 17:54615268-54615290 GAAAATCAATAAGGAAAAAGTGG + Intergenic
1149704728 17:58684722-58684744 ATAGATTAATAGGGAGGCAGAGG + Intronic
1149982659 17:61323693-61323715 GTGGCCTATTAAGGAAACAGAGG - Intronic
1152527657 17:80898368-80898390 GAGGATTAATCAGGAAAAAGGGG - Intronic
1203168659 17_GL000205v2_random:124898-124920 TAAGATGAATAAGTAAACAGAGG + Intergenic
1153149253 18:2071381-2071403 GTACATTAATCAGGAAAAAGAGG - Intergenic
1154040161 18:10847024-10847046 TTTTATAAATAAGGAAACAGAGG + Intronic
1154938053 18:21080962-21080984 GAAGATTAATAAAAAAACAGAGG + Intronic
1154966203 18:21359153-21359175 CTACATTAATAAGAAATCAGGGG + Intronic
1155484140 18:26323255-26323277 GATGATCAATAAGGAAACAGAGG - Intronic
1155839742 18:30630481-30630503 TTAACTTAATAAGGAAATAGAGG + Intergenic
1156077411 18:33297430-33297452 GTAGATTAACAAAGAAAAAAAGG + Intronic
1156137032 18:34054238-34054260 AAAGATGAATAAGGAAATAGAGG - Intronic
1156746433 18:40397129-40397151 ATAGATTGATAAGAAAATAGTGG + Intergenic
1157708362 18:49828530-49828552 GAAGATCAATAAGAAAATAGAGG + Intronic
1158616210 18:58989922-58989944 GAAAATTAATAAGGAAACATTGG + Intergenic
1158728830 18:60000935-60000957 CTGGATAAATAAGGAAACAAAGG - Intergenic
1158793840 18:60817380-60817402 GTAGATTAATAACACAATAGAGG - Intergenic
1158971363 18:62670101-62670123 GAAGATCCATAAGGAAACAGAGG - Intergenic
1159311018 18:66709086-66709108 GTTGATTATTTAGGAAACATTGG + Intergenic
1159360382 18:67394085-67394107 GAAGATTGATAAGGAAGCAGAGG + Intergenic
1159888571 18:73934075-73934097 GTAGAGAAATAAGGAAGCATGGG + Intergenic
1160208266 18:76855452-76855474 GTTGACTAATAAGGGTACAGAGG - Intronic
1160398718 18:78592213-78592235 GAAGATCAATAAGGAAATAGAGG + Intergenic
1160804024 19:983736-983758 GTCGACCAATAAGGAAACACTGG + Intergenic
1162412786 19:10516755-10516777 GGGGATTAATAAGGTCACAGAGG - Intronic
1162840571 19:13353462-13353484 GGAGAATATTAAGGATACAGGGG - Intronic
1163868718 19:19799312-19799334 GTATATTAGTAAGGGAACAGAGG + Intronic
1163902349 19:20114813-20114835 GAATATTAGTAAGGGAACAGGGG - Intronic
1163971671 19:20802723-20802745 GAATATTAATAAGGGAACAGAGG - Intronic
1164103858 19:22085530-22085552 GAATATTAATAAGGAAACAGTGG - Intronic
1164482828 19:28627566-28627588 GAAAATAAATAAGGGAACAGTGG + Intergenic
1164723606 19:30450820-30450842 GCAGAAAAATAAGGAAGCAGGGG - Intronic
1166023983 19:40062705-40062727 GAAGATAAATAAGGAAATAGGGG - Intergenic
1166077855 19:40424527-40424549 GTAAATAAATAAGGAAACACAGG + Intronic
1166610389 19:44188164-44188186 GAAGATCAATGAGGAAACGGAGG - Intergenic
1167978025 19:53247529-53247551 GAAGATTAGTAAGGAAATAAAGG - Intronic
1168011098 19:53533529-53533551 GAAAATCAATAAGGAAACACTGG - Intronic
925191674 2:1889731-1889753 GTAGATAAATAGGGAAATGGAGG - Intronic
925729768 2:6910866-6910888 GTAGAAGAATGAGGACACAGGGG + Intergenic
926580326 2:14627752-14627774 GTCTATTAATAAGGAAAAAGAGG + Intergenic
927632033 2:24782948-24782970 GAAGATTAATCTGGCAACAGAGG - Intergenic
928102521 2:28447532-28447554 GTATATTGATGAGGAAACTGAGG + Intergenic
928271659 2:29860480-29860502 GAAAATCAATAAGGAAACACTGG + Intronic
928891566 2:36209762-36209784 GAAAATCAATAAGGAGACAGTGG - Intergenic
929065120 2:37964727-37964749 GATGATTAGTAAGGAAATAGAGG - Intronic
930418276 2:51117650-51117672 GTAAAGTAATAAGGACGCAGAGG + Intergenic
931135886 2:59399894-59399916 GAAGATTGATAAGGAAACATTGG + Intergenic
932843221 2:75104487-75104509 GAAAATTAGTAAGGAAACATAGG + Intronic
933489828 2:82971090-82971112 GAATATCAATAAGGAAATAGAGG + Intergenic
933863624 2:86495853-86495875 GAACATCAATAAAGAAACAGAGG - Intergenic
934959079 2:98652162-98652184 GAAGATCAATAAGGAAACATCGG + Intronic
935497209 2:103795448-103795470 GTTAATTTATAAGGAAAAAGAGG + Intergenic
935533486 2:104264185-104264207 GAAAATCAATAAGGAAACATTGG + Intergenic
935605010 2:104962900-104962922 GAAGATCAATAAGGAAGCAGAGG - Intergenic
935654815 2:105412977-105412999 GTAGCTCAGTAAGGAAACTGAGG + Intronic
936273002 2:111066145-111066167 GTAAATGATTAAGGAAACTGTGG + Intronic
937055374 2:118930583-118930605 GAAGATAAGTAAGGAAACAGGGG - Intergenic
937372366 2:121308855-121308877 GAAGATCAATAAGAAAATAGGGG + Intergenic
937834367 2:126457397-126457419 GAAAATTAGTAAGGAAATAGTGG + Intergenic
937962802 2:127474552-127474574 CTAGATCAAAAAAGAAACAGAGG + Intronic
938325500 2:130396140-130396162 GAAGATCAATACAGAAACAGAGG + Intergenic
938423464 2:131164059-131164081 GAAGATCAATACAGAAACAGAGG - Intronic
938929756 2:136076295-136076317 GCAGATTAATAAGGAGATAATGG + Intergenic
939240744 2:139556784-139556806 TTAAATTAATAAGGGAACATTGG - Intergenic
939379771 2:141420051-141420073 GGAGATCAATAAGGAAGCAGAGG - Intronic
941116379 2:161477282-161477304 GAAAATCAAGAAGGAAACAGCGG - Intronic
941122089 2:161542142-161542164 GAAGATTAATAAGGAAACACTGG + Intronic
941611880 2:167671262-167671284 AAAAATCAATAAGGAAACAGTGG + Intergenic
941851982 2:170192453-170192475 ATAGATTAATCAAGAAAAAGAGG - Intronic
942059634 2:172216079-172216101 GTGAATTTATGAGGAAACAGAGG + Intergenic
942821427 2:180120461-180120483 GTAGAGTAATAAGGAAATCTGGG - Intergenic
943203215 2:184857517-184857539 GAAAATCAATAAGGAAACATGGG - Intronic
943293867 2:186112314-186112336 GAAAATTAATAAGGAAACACTGG - Intergenic
943313124 2:186352623-186352645 GTAAATTCATAAGGATAGAGTGG + Intergenic
943435639 2:187863009-187863031 GTAAATTAAGAAAAAAACAGTGG - Intergenic
943542036 2:189227809-189227831 GAAGATTAATAAAGAAACAGAGG + Intergenic
943600226 2:189908896-189908918 GAAAATGAATAAGGAAACACTGG - Intronic
943626616 2:190208448-190208470 ATATATAAATTAGGAAACAGTGG + Intronic
943907399 2:193517208-193517230 GTAAATTTATAAAGAAAAAGAGG + Intergenic
943910296 2:193556828-193556850 TTAGATTAAAGAGAAAACAGGGG - Intergenic
944346975 2:198679978-198680000 GAAGATCAATAAAGAAACAAAGG + Intergenic
944593579 2:201240629-201240651 GAAGATTAATAAGGAAACAGGGG + Intronic
945198169 2:207256808-207256830 GTAGAAAAATGAGGAAACAAAGG - Intergenic
945385596 2:209196166-209196188 GAAGATAAGTAAGGAAATAGAGG + Intergenic
945389743 2:209249685-209249707 GAAAATCAATAAGAAAACAGTGG + Intergenic
945732539 2:213556693-213556715 GAAAAATAATAAGGAAACACTGG + Intronic
946917630 2:224541670-224541692 GTAAATGAATAAGCAAACTGTGG + Intronic
948539218 2:238674905-238674927 ATAGATGAATAAAGAAACTGTGG - Intergenic
1169316503 20:4595155-4595177 ATAAATTAATAAGCAAACATTGG - Intergenic
1169472052 20:5894942-5894964 TTGGATGAATAAGGAAAAAGAGG - Intergenic
1170109409 20:12788819-12788841 GCAAATTAATAAGGAAGCATGGG - Intergenic
1170257881 20:14366139-14366161 TGAGATTAATAAGGAAATACAGG - Intronic
1170637499 20:18120327-18120349 GAATATTAATAAGAAAACAGAGG + Intergenic
1170660992 20:18339685-18339707 GAAGATTAATAAGGAAACAGAGG + Intergenic
1171098688 20:22360203-22360225 GAAGATTAATAAAGAAACAGAGG + Intergenic
1171162020 20:22935325-22935347 GAAGATCAGTAAGGAAATAGAGG - Intergenic
1171445572 20:25201289-25201311 GAAGATCAATATAGAAACAGAGG - Intronic
1172968095 20:38853072-38853094 CTCGATTAGAAAGGAAACAGTGG - Intronic
1173230887 20:41196126-41196148 GAAGATCAATCAGGAAATAGAGG - Intronic
1173827000 20:46054501-46054523 GTAGATTAATGAAAACACAGAGG - Intronic
1175559353 20:59907192-59907214 GGAGATTAGTAGGGAAACATGGG + Intronic
1175644109 20:60656874-60656896 GTACATTCATAAGGAAATAGAGG - Intergenic
1176403102 21:6334240-6334262 TAAGATGAATAAGTAAACAGAGG - Intergenic
1176434055 21:6654864-6654886 TAAGATGAATAAGTAAACAGAGG + Intergenic
1178017282 21:28363810-28363832 GAATATCAATAAGTAAACAGAGG - Intergenic
1178153696 21:29826537-29826559 TCAGATTTAAAAGGAAACAGTGG + Intronic
1178254347 21:31037975-31037997 ATATATTAATAAGGGAAGAGAGG + Intergenic
1178430184 21:32512087-32512109 CTATATAAAAAAGGAAACAGGGG + Intronic
1178792985 21:35717400-35717422 GTAGATTTGTAAGGTAGCAGAGG + Intronic
1179026053 21:37679392-37679414 TTATATGAGTAAGGAAACAGAGG - Intronic
1179156577 21:38856716-38856738 GTAGCTTAATAAGCAAAAGGTGG + Intergenic
1179831152 21:43997237-43997259 GAAGATTAACAAAGAAACATTGG - Intergenic
1181589201 22:23872831-23872853 GAAGATTAATAACGAGATAGGGG - Intronic
1181658266 22:24319064-24319086 GTAGATCAATGAGGTAAAAGAGG - Intronic
1181730310 22:24841499-24841521 GAATATCAATAAGGAAACAGAGG - Intronic
1182603061 22:31482314-31482336 GTCATTTAATAAGGAATCAGTGG + Intronic
1182640733 22:31765117-31765139 TTAGATTACTAAGGAAACAATGG + Intronic
1184287769 22:43481663-43481685 GAAGAGGAAGAAGGAAACAGAGG - Intronic
1184317290 22:43705327-43705349 AAAAATTAATAAGGAAACACTGG + Intronic
1184635675 22:45827734-45827756 GAAGGTAAGTAAGGAAACAGAGG + Intronic
1185124417 22:48999360-48999382 GTAGTTTCATAAAGAAAAAGAGG + Intergenic
949183541 3:1164156-1164178 GGATATGAAGAAGGAAACAGAGG - Intronic
949604203 3:5635580-5635602 TTACATTTATAAGGAAATAGTGG + Intergenic
950323000 3:12075132-12075154 CTAGATAAATGAGGAAACTGAGG + Intronic
950697176 3:14711203-14711225 GAAGATCAATAAAGAAATAGAGG - Intronic
950794203 3:15497385-15497407 GTAGATGAAGATGGATACAGTGG - Intronic
951060115 3:18196268-18196290 GAAGATAAGTAAGAAAACAGAGG - Intronic
951183531 3:19686331-19686353 GAAGATTAAAAAGGAAATAGAGG + Intergenic
951472535 3:23071621-23071643 GGAGAGTAATAAGGAAATTGGGG - Intergenic
952251202 3:31656661-31656683 CAGGATCAATAAGGAAACAGAGG + Intergenic
953224654 3:41007157-41007179 GAAAATCAATAAGGAAACAGAGG - Intergenic
953501586 3:43440655-43440677 TAAGATCAATAAGGAAACAGAGG + Intronic
953630930 3:44616546-44616568 GAAGATCAATAAGGAAATAGAGG + Intronic
954475315 3:50738597-50738619 GTAGGTTATAAAGGAAAAAGAGG + Intronic
954880204 3:53830599-53830621 GAAGATCAGTAAGGAAACAGAGG + Intronic
954956472 3:54524524-54524546 GAAGATTAATATGGAAATAAAGG - Intronic
955100845 3:55848316-55848338 GAAGAATAATTAGGAAAAAGAGG - Intronic
955262003 3:57400818-57400840 GAAGATCAATAAGGAAATAGAGG + Intronic
955902134 3:63768042-63768064 GTAGAATCCTAATGAAACAGAGG + Intergenic
956035461 3:65086187-65086209 GTATATTATTGAGGAATCAGAGG + Intergenic
957688760 3:83539732-83539754 GTAGATTAATAAGTCACTAGAGG + Intergenic
957732953 3:84165734-84165756 GCAGATAAGTAAGGAAATAGAGG - Intergenic
958438422 3:94126152-94126174 GTATATTAAAAAGAAACCAGGGG - Intronic
958515163 3:95106038-95106060 GTAGATTTATAAAGAATCAGTGG + Intergenic
958613695 3:96461645-96461667 GTAAATTAGTAAAGAAACTGTGG + Intergenic
958931866 3:100215992-100216014 GTGGATTAAAAAGGACACAAAGG - Intergenic
959130276 3:102346512-102346534 GTATATTATTTAGGAAATAGGGG + Intronic
959212176 3:103399331-103399353 GAAAATCAATAAAGAAACAGAGG + Intergenic
959280891 3:104337529-104337551 GAAAATGAATAAGAAAACAGTGG + Intergenic
959402365 3:105918872-105918894 GAAAATTAATAAGGAAACTTTGG - Intergenic
959987513 3:112591917-112591939 GAAGATAAGTAAGGAAACAGAGG - Intergenic
960067129 3:113385942-113385964 GAAAATCAATAAAGAAACAGAGG - Intronic
960294047 3:115920732-115920754 CAAGATGAATAAGAAAACAGAGG - Intronic
960312434 3:116132877-116132899 CTAGATTGATAGGGAGACAGAGG - Intronic
960533340 3:118789578-118789600 GTTTATTAATAAGGACACATGGG - Intergenic
961070642 3:123921605-123921627 GAAAATCAATAAGGAAACATTGG + Intronic
961392481 3:126561650-126561672 GAAGATCAATAAAGAAATAGAGG - Intergenic
961416522 3:126762617-126762639 ACAGATTAATAAGAAAACAGAGG - Intronic
961500717 3:127332243-127332265 GAAAATCAATAAGAAAACAGTGG + Intergenic
962489203 3:135875315-135875337 AGAGATCAATAAGGAAACAGAGG + Intergenic
962853522 3:139325319-139325341 GGTGATTTATAAGGAAAAAGAGG + Intronic
963362320 3:144290107-144290129 CTAGTTTAATAAGCAAAAAGTGG - Intergenic
964240167 3:154583537-154583559 GTAGATGAATAAACAAACTGTGG + Intergenic
964349110 3:155785306-155785328 GAAGATAAGTAAGGAAAAAGAGG + Intronic
964441909 3:156720273-156720295 GGAGATTAAGAATGAAAAAGTGG - Intergenic
965057449 3:163740507-163740529 GAAAATTAATAAGGAAAAACTGG + Intergenic
965723765 3:171690866-171690888 GAAGATAAGTAAGAAAACAGAGG - Intronic
965723838 3:171692287-171692309 ATAGAATAATAAAGAAACATTGG + Intronic
966281013 3:178229125-178229147 GAAGATCAATAAGGAAATAGAGG - Intergenic
970037027 4:11748006-11748028 GTAAAATAACAAGGAAACAAAGG - Intergenic
970134866 4:12911604-12911626 GTAGACTCATAAGGGACCAGTGG - Intergenic
970363730 4:15337133-15337155 GGTGATTTATAAGGAAAAAGAGG + Intergenic
970764158 4:19526533-19526555 GAAAATCAATAAGGAAACACTGG - Intergenic
971613618 4:28758776-28758798 GTGGAAAAATCAGGAAACAGTGG + Intergenic
971656809 4:29357951-29357973 TGAGATCAATAAGGAAAGAGAGG - Intergenic
971827933 4:31651676-31651698 GTAGACAAGTAAGGAAACAAAGG + Intergenic
972122338 4:35719824-35719846 GTAGAGTAATAAGTACACACTGG - Intergenic
972924053 4:43981938-43981960 GAAGATTAATAAAGAAAAAAGGG - Intergenic
973043797 4:45509732-45509754 GAAGACCAATAAGAAAACAGAGG - Intergenic
973216793 4:47678526-47678548 GTAGATAAATAATGAAATATTGG - Intronic
973667136 4:53172880-53172902 GGAAATTAATAAGGAAACATTGG - Intronic
973708853 4:53606186-53606208 GTAGACTAATAAAGAAAAAAAGG + Intronic
974369920 4:61002539-61002561 ATAGATCAATAAAGAAATAGAGG + Intergenic
974570009 4:63633075-63633097 GTAGGTTACTATGGAAACATGGG + Intergenic
974754510 4:66186290-66186312 TAAAATCAATAAGGAAACAGTGG - Intergenic
975247144 4:72132373-72132395 GTAGATGAATAAAGAAAATGTGG - Intronic
975347350 4:73307389-73307411 GCACAATAATAAGGAAACAAGGG + Intergenic
975899572 4:79135924-79135946 CTAGATTAATAAAGAAAAAAAGG - Intergenic
976074837 4:81285803-81285825 ATAGCTTAATAATGAAACTGAGG + Intergenic
977026428 4:91823962-91823984 AAAGGTCAATAAGGAAACAGAGG - Intergenic
977187037 4:93951663-93951685 GAAGATCAATAAGAAAACAGAGG + Intergenic
977868823 4:102064495-102064517 GTTTATAAATAAGGAAACTGAGG + Intronic
978258900 4:106727630-106727652 GAAGATTAGTAAGGAAGTAGAGG + Intergenic
978948785 4:114530775-114530797 GAGAATTAATAAGGAAACACTGG + Intergenic
978994563 4:115133894-115133916 GAAAATTAATAAAGAAACATTGG + Intergenic
979488105 4:121292335-121292357 GAAAATCAATAAGGAAATAGTGG + Intergenic
979746919 4:124227149-124227171 GAAAATTAATAAGGAAACACTGG + Intergenic
980445127 4:132895317-132895339 GAAAATTAATAAAGAAACAATGG + Intergenic
980718200 4:136656306-136656328 GTAGATGAATAAAGAAAATGTGG - Intergenic
982310941 4:153984222-153984244 GTAGATTAAAAAATAAACACCGG - Intergenic
982897028 4:160943702-160943724 GTAGGTGAATAAGAAAACTGTGG + Intergenic
985347385 4:189020408-189020430 TTAGAATAAATAGGAAACAGGGG + Intergenic
987347146 5:16989271-16989293 GCAAATTCATTAGGAAACAGAGG + Intergenic
987936877 5:24478401-24478423 ATAAATAAATAGGGAAACAGAGG + Intergenic
988032880 5:25787786-25787808 GAAAATCAATAAGGAAATAGAGG - Intergenic
988391404 5:30638033-30638055 GAAGATCAATAAGAAAACAGAGG - Intergenic
988642233 5:33052825-33052847 GAAAATTAATAAGGAAATACTGG + Intergenic
988649730 5:33135394-33135416 GAAAATTAATAAGAAAACATTGG - Intergenic
989251573 5:39321952-39321974 GAAAATTATTAAGGAAACATTGG + Intronic
989340137 5:40364827-40364849 GTAGAGTAATAAGGGATCATGGG - Intergenic
990178549 5:53134675-53134697 TTAAATTAATGAGGAAACTGAGG - Intergenic
990229458 5:53696031-53696053 GAAAATTAATAAGGAAATACTGG + Intergenic
991276035 5:64847487-64847509 GAAAATTAATAAGGAAACACTGG + Intronic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
993846509 5:92951113-92951135 GAAAATTAACAAGGAAACACTGG - Intergenic
994326288 5:98449590-98449612 GAAAATCAATAAGGAAACATCGG + Intergenic
994468830 5:100176090-100176112 GTAGATTTATTAGCAAAAAGTGG + Intergenic
995104517 5:108359829-108359851 GAAGATTAACAAAGAAGCAGAGG - Intronic
995235101 5:109819946-109819968 GTAGATTAATTAGGCAAAAGGGG + Intronic
995684327 5:114755786-114755808 GCAGATTAAAAAGGAGACAATGG + Intergenic
996041115 5:118812516-118812538 GAAAATCAATAAGGAAATAGTGG + Intergenic
997086036 5:130800526-130800548 GAAAATTAATATGGAAACATTGG + Intergenic
997109327 5:131057708-131057730 GAAGATCAGTAAGGAAACAGAGG + Intergenic
997940526 5:138153403-138153425 ATACATTAATAAGAAAGCAGAGG - Intronic
998381629 5:141730033-141730055 CTAGATTACTGAGGAATCAGAGG - Intergenic
999072235 5:148757135-148757157 GAAAATCAATAAGGAAACAGTGG - Intergenic
999079930 5:148833430-148833452 TTAGAGAAAGAAGGAAACAGAGG - Intergenic
999355448 5:150925707-150925729 GAAAATCAATAAGGAAACATCGG - Intergenic
999579690 5:153023116-153023138 GAAAATAAATAAGGAAACATTGG + Intergenic
1000777332 5:165436692-165436714 AGAGATCAATTAGGAAACAGTGG - Intergenic
1002149949 5:177220086-177220108 GAAGATCAATAAAGAAACAGAGG - Intronic
1003470497 6:6426215-6426237 ATAGATCAAAAAGGAAATAGAGG + Intergenic
1003887878 6:10537140-10537162 GTAGATTATCAAGAAAACAATGG + Intronic
1003932343 6:10937039-10937061 GAAAATCAATAAGGAAACAGTGG + Intronic
1003935688 6:10973001-10973023 TTCTGTTAATAAGGAAACAGGGG + Intronic
1004413359 6:15401999-15402021 GTGAGGTAATAAGGAAACAGGGG + Intronic
1006203274 6:32316284-32316306 GTAGGGTAATAAGGAAGCAAGGG + Intronic
1006477280 6:34264779-34264801 GATGATCAATAAGGAAACATAGG + Intergenic
1008020434 6:46571263-46571285 GAAAATCAATAAGGAAACATGGG - Intronic
1008181056 6:48329730-48329752 ATAGATTAATAAAGAAATAGCGG + Intergenic
1009347380 6:62632051-62632073 AAAAATCAATAAGGAAACAGAGG + Intergenic
1009623375 6:66104385-66104407 GAAGATTAATAAGGACACTTAGG - Intergenic
1009781153 6:68272316-68272338 GTAAATTAATAAAGGAACTGAGG + Intergenic
1009928344 6:70147064-70147086 GTAAGTTAATAAACAAACAGTGG - Intronic
1010156733 6:72802943-72802965 GAAGAATCATAAGGAAATAGGGG - Intronic
1010316127 6:74452486-74452508 GTAGACTGAGATGGAAACAGAGG - Intergenic
1011518356 6:88176994-88177016 GTAGATAAATGAAGAAACATAGG - Intergenic
1012099941 6:95020523-95020545 GTAGATTAAAAAGGAACATGTGG - Intergenic
1012264057 6:97119866-97119888 GGAGATTAAGAAGGAAAGAAAGG + Intronic
1012688297 6:102280649-102280671 GAAAATCAATAAGGAAATAGTGG - Intergenic
1014528311 6:122527915-122527937 GAATATCAATAAGAAAACAGGGG - Intronic
1014562852 6:122912677-122912699 GAAAATTAATAAGGAAACATTGG - Intergenic
1014803477 6:125803309-125803331 ATAAAATAATCAGGAAACAGGGG - Intronic
1014955857 6:127614969-127614991 GAAGATGAACAAGAAAACAGAGG + Intergenic
1015171179 6:130255337-130255359 GAAAATTAATAAGGAAACACTGG - Intronic
1015542618 6:134331113-134331135 AAAGAATAATAATGAAACAGTGG + Intergenic
1015693026 6:135946973-135946995 GTAGATAAATAATGAAAAACTGG - Intronic
1016127321 6:140420735-140420757 GTAGCTTAATTAGGAAACATTGG - Intergenic
1016193395 6:141299272-141299294 GGACACTAATAAGGAGACAGGGG + Intergenic
1016349040 6:143147436-143147458 GTTGATTTTTAAGGAAACAAAGG - Intronic
1016440154 6:144075110-144075132 CTCGTTTAATAAGGAAGCAGAGG + Intergenic
1016586665 6:145695894-145695916 GAAAATCAATAAGGAAACATTGG + Intronic
1016793542 6:148092670-148092692 AAAAATTAATAAGGAAACATTGG + Intergenic
1017164420 6:151393863-151393885 GTACAGTAATAAGGAAAAAAAGG + Intergenic
1017673467 6:156790357-156790379 TTAGATTACTGAGTAAACAGTGG + Intronic
1018675470 6:166218274-166218296 GTAAATGAATAAGCAAACTGTGG + Intergenic
1020177545 7:5895146-5895168 GTAGAGTAACCAGGGAACAGGGG - Intergenic
1020919927 7:14250682-14250704 GAAAATCAATAAGGAAACAGTGG - Intronic
1021160555 7:17268019-17268041 GAAAATCAATAAGGAAACATTGG - Intergenic
1022137312 7:27460951-27460973 TTACATTAAAAAGGAAATAGTGG - Intergenic
1022877213 7:34546545-34546567 TAAAATCAATAAGGAAACAGTGG - Intergenic
1022897668 7:34768728-34768750 TTAGATTAGTTAGGAAACTGCGG + Intronic
1023332888 7:39138150-39138172 ATAGTTTCATAAGGAAACAGAGG - Intronic
1023725436 7:43138420-43138442 GTAAATTAATTAGGAACCACCGG + Intronic
1023840623 7:44095684-44095706 GTAGAAAAATAAGAAAACACAGG - Intergenic
1023853781 7:44167383-44167405 GAAGATCAATAAGGAAAGAGAGG + Intronic
1024435607 7:49350930-49350952 AGAGATTAATAATGAAATAGAGG - Intergenic
1024747950 7:52429314-52429336 TTAGATTAAAAAGGAAATTGGGG - Intergenic
1025140938 7:56463625-56463647 GAATATTAATAAGGGAACAAAGG - Intergenic
1025163594 7:56689629-56689651 GAACATTAATAAGGCAACAAAGG + Intergenic
1025706723 7:63872812-63872834 GAACATTAATAAGGGAACAAAGG - Intergenic
1027695131 7:81401183-81401205 TTATACAAATAAGGAAACAGTGG - Intergenic
1028067362 7:86403758-86403780 GTACAATATTAAGCAAACAGGGG + Intergenic
1028105434 7:86871594-86871616 GAAAATCAATAAGGAAACATTGG + Intergenic
1028335770 7:89652828-89652850 CTATAAAAATAAGGAAACAGAGG + Intergenic
1030316230 7:108117247-108117269 TTAGATAAAGAAGGAAACAAAGG + Intronic
1030417133 7:109259438-109259460 GTATACTAATAATTAAACAGTGG - Intergenic
1030478779 7:110075270-110075292 GGAGATTGATAATGAAAAAGTGG + Intergenic
1030719518 7:112853450-112853472 GTATTTTAATAAGGAAATATAGG + Intronic
1030831561 7:114229364-114229386 TAAGATCAATAAGGAAAAAGAGG + Intronic
1030919567 7:115365114-115365136 GAAAATTAATAAGGAAACATTGG - Intergenic
1030994744 7:116345785-116345807 GAAAATAAGTAAGGAAACAGAGG + Intronic
1031715244 7:125101162-125101184 TTATTTTAATAAGGAAATAGTGG + Intergenic
1032526646 7:132582856-132582878 GTAGAATAAGAAGGACAAAGTGG + Intronic
1032770567 7:135050424-135050446 GATGATCAATAAGGAAACAGAGG - Intronic
1033889717 7:145996496-145996518 GAATATTGATAAGGAAATAGAGG - Intergenic
1034712984 7:153212480-153212502 GAGGATAAATAAGGAAAGAGAGG - Intergenic
1035005658 7:155658003-155658025 AAAGATTAATAAGGATATAGAGG - Intronic
1035315371 7:157994261-157994283 TTAAATTAAAAAGGAAGCAGTGG - Intronic
1035627849 8:1086859-1086881 GAAAATTAATAAGAAAACATTGG + Intergenic
1036635085 8:10544063-10544085 GAAGATTAACAAGGATAAAGAGG - Intronic
1036957796 8:13209226-13209248 ATAGATTTATAAGGATACATAGG - Intronic
1037036707 8:14177823-14177845 GCAGATAGAAAAGGAAACAGAGG - Intronic
1037189338 8:16103273-16103295 GAAGATCAATAAGGAGATAGAGG - Intergenic
1037537895 8:19843936-19843958 TTAGAGTAAGAAGGAAACAAAGG - Intronic
1038074741 8:24058789-24058811 GAAAATCAATAAGGAAACATTGG + Intergenic
1038750224 8:30287853-30287875 GTAATTTAAAAAGGCAACAGTGG - Intergenic
1039084863 8:33769934-33769956 AAAGATTAATAAGAATACAGAGG - Intergenic
1039625603 8:39048613-39048635 GAAGATCAATACGGAAACACAGG - Intronic
1039636640 8:39174479-39174501 ATAAATAAATAAGGAAACTGAGG - Intronic
1040427789 8:47306634-47306656 GAAGATAAGTAAGGAAACAGAGG - Intronic
1040518764 8:48156734-48156756 GATAATTAATAAGGAAACAGTGG + Intergenic
1040750018 8:50693564-50693586 GAAAATTAATAAGGAAATACTGG + Intronic
1040895038 8:52357803-52357825 ATAGATCCATAAGGAAATAGAGG + Intronic
1040896061 8:52369572-52369594 GGAGATTTATAAAAAAACAGTGG - Intronic
1040899114 8:52399949-52399971 TAAAATTAATAAGGAAACACTGG - Intronic
1040918119 8:52584831-52584853 GTAGGTAAATAAAAAAACAGGGG - Intergenic
1040967224 8:53095461-53095483 GAAGATTAATAAGGAATTAAGGG + Intergenic
1041160013 8:55030925-55030947 GAAAATTAATAAGGAAATACTGG + Intergenic
1041206617 8:55505795-55505817 GAAGATTAATAAGGAAATAGAGG - Intronic
1041508194 8:58624784-58624806 GGACATCAGTAAGGAAACAGAGG - Intronic
1043268492 8:78298715-78298737 GTATATAAATATGGAAGCAGAGG + Intergenic
1043318991 8:78958142-78958164 AGAGATAAAGAAGGAAACAGTGG + Intergenic
1043781412 8:84340169-84340191 GTAATTTAATAAAGAAAAAGAGG - Intronic
1044485377 8:92747102-92747124 GTTGATAGATAAGAAAACAGAGG - Intergenic
1044502347 8:92972844-92972866 GTAGATCATTAAACAAACAGGGG - Intronic
1044901351 8:96948682-96948704 GAAGATAAGTAAGGAAACAGAGG - Intronic
1044943578 8:97368855-97368877 GAAGATTAGTAAGTAAATAGAGG + Intergenic
1045201180 8:99983179-99983201 GTAGATTGATAAAGAAAATGTGG - Intronic
1045220466 8:100194214-100194236 GAAGATGAAGAAGGAAAAAGCGG + Exonic
1045879185 8:107017752-107017774 GGAAATCAATAAGGAAACATTGG + Intergenic
1045958691 8:107940790-107940812 ATAGATGAATAAGGAAAAAATGG + Intronic
1046040772 8:108901113-108901135 GAAGATAAATAAGAAAACAGAGG + Intergenic
1046517275 8:115279356-115279378 GAAGACTGATAAGGAAACAGAGG + Intergenic
1046696594 8:117347202-117347224 GAAAATTAATAAGAAAACAGTGG + Intergenic
1047971882 8:130091674-130091696 GTTTATATATAAGGAAACAGAGG - Intronic
1048802777 8:138209393-138209415 GTAGATACATAAGGAATAAGAGG + Intronic
1049070713 8:140353520-140353542 GTAGCTTAAAAAGGGAACACGGG - Intronic
1049321455 8:141999085-141999107 ATTGATTAAGAAGGAAAGAGAGG - Intergenic
1049366094 8:142237545-142237567 TTCGATTGATAAGGAAACGGAGG - Intronic
1050173542 9:2846984-2847006 TTAGATAAATATGGAAACTGAGG - Intergenic
1050676473 9:8061136-8061158 GAAAATTAATAAGGAAACATAGG - Intergenic
1050980910 9:12014227-12014249 GAAGATCAATAAGGCAATAGGGG - Intergenic
1051471144 9:17443886-17443908 GTACTTTAATAAAGAAACAAGGG + Intronic
1051687827 9:19676498-19676520 ATAGATAAACAAGGAAACAAAGG - Intronic
1051847816 9:21472348-21472370 TTACATTGATGAGGAAACAGAGG - Intergenic
1052267737 9:26593700-26593722 GAAAATCAATAAGGAAACATTGG - Intergenic
1052478118 9:28988071-28988093 GAAAATTAATAAGGAAACACTGG - Intergenic
1052600399 9:30620699-30620721 GAAGATCAATAAGAAAATAGAGG - Intergenic
1052636369 9:31111007-31111029 ATAGCTTAATAAAGAAACAGTGG + Intergenic
1053038179 9:34844862-34844884 GAAAATCAATAAGGAAACATTGG - Intergenic
1053523213 9:38802995-38803017 GAAGATCAATAAAGAAATAGAGG - Intergenic
1054195440 9:62027414-62027436 GAAGATCAATAAAGAAATAGAGG - Intergenic
1054642967 9:67561275-67561297 GAAGATCAATAAAGAAATAGAGG + Intergenic
1055388052 9:75785696-75785718 CTAGATTAATAAAGAAAAAAAGG - Intergenic
1055532368 9:77197298-77197320 GAAGATTAATAAGGAAATATAGG - Intronic
1055536863 9:77256526-77256548 GTAGATTAATAAGGAAACAGGGG - Intronic
1055683974 9:78750399-78750421 GAAAATTCATAAGGAAACATTGG - Intergenic
1056162249 9:83908451-83908473 GAAGATGAAAAAGGAAACACAGG - Exonic
1056796516 9:89662495-89662517 GAAGATTCCTAAGAAAACAGAGG + Intergenic
1057217069 9:93234987-93235009 GTTAATTAATAAGGACACAGAGG + Intronic
1057692659 9:97299752-97299774 GAAGATTCATAAGGAAATGGAGG + Intergenic
1057807650 9:98231733-98231755 TTAGATTAATAAGGAAACTGAGG - Intronic
1058270870 9:102969761-102969783 GAAAATTAATAAGAAAACATTGG - Intergenic
1059218289 9:112587861-112587883 GTTGATAAATCAAGAAACAGAGG - Intronic
1059490619 9:114663432-114663454 GTAGCTTAATCAGGAAAAAAAGG + Intergenic
1060425660 9:123503260-123503282 TTTGATGAATAAGGAGACAGAGG - Intronic
1060669607 9:125458309-125458331 GCAGATTAATAAGTGAACAAAGG + Intronic
1062558154 9:137126191-137126213 GCAGATCAACAAGGAAATAGAGG - Intergenic
1203437476 Un_GL000195v1:153799-153821 TAAGATGAATAAGTAAACAGAGG - Intergenic
1186021799 X:5264530-5264552 GGTAATTTATAAGGAAACAGAGG + Intergenic
1186377909 X:9027043-9027065 GTAGATAATTTAGGAAGCAGTGG - Intronic
1186724134 X:12338763-12338785 TTTTATAAATAAGGAAACAGAGG + Intronic
1187839108 X:23467389-23467411 TGTGATTAATAAGGAAACAGAGG + Intergenic
1188264578 X:28055957-28055979 GTAGATTCAGAAGAAAACAGAGG - Intergenic
1188678681 X:32975074-32975096 TTAGAATAATCAGGAACCAGTGG + Intronic
1188902809 X:35755097-35755119 GAAGATAAATAAGGAAAGAGAGG + Intergenic
1189294611 X:39909715-39909737 CCAGGTTAATAAGGAAATAGGGG + Intergenic
1189625877 X:42896015-42896037 TTATGTTAATAAGGATACAGAGG + Intergenic
1189894219 X:45636953-45636975 CTAGATTAACAAAGAAACAAAGG + Intergenic
1190332483 X:49244408-49244430 AGAGATTAAGAAGTAAACAGAGG - Intronic
1190799075 X:53771818-53771840 GTGGCTTAAGAAGGAAAAAGTGG + Intergenic
1190971305 X:55351882-55351904 GAAAATTAATCAGGAAACATGGG - Intergenic
1191065679 X:56344514-56344536 GAAAATCAATAAGGAAACATAGG - Intergenic
1191957020 X:66653461-66653483 GAAAATCAATAAGAAAACAGTGG + Intergenic
1192052228 X:67735013-67735035 TTATATAAATAAGGAAACTGAGG + Intergenic
1192105845 X:68316065-68316087 ATAAATTAATAGGGATACAGAGG + Intronic
1192134466 X:68583816-68583838 ATAGAGTTAGAAGGAAACAGGGG + Intergenic
1192225918 X:69227757-69227779 GCAGCTGAATAATGAAACAGGGG - Intergenic
1192738176 X:73868890-73868912 GTAAATCAATGAGGAAACATAGG + Intergenic
1192840713 X:74852418-74852440 GAAAATTAATAAAGAAACATTGG + Intronic
1192947559 X:75982723-75982745 GTTGATTAATAGGGCATCAGTGG - Intergenic
1193272195 X:79542723-79542745 GAAAATCAATAAGGAAACATTGG - Intergenic
1193533773 X:82687780-82687802 AAAAATAAATAAGGAAACAGTGG - Intergenic
1193624633 X:83802665-83802687 GAAAATCAATAAGGAAACAATGG - Intergenic
1193706558 X:84827059-84827081 AAAGATTAATACAGAAACAGAGG - Intergenic
1194487849 X:94507827-94507849 GTAGAGTATTAAGGAAAAAAAGG + Intergenic
1195130930 X:101851210-101851232 GAAGATCAATAAGAAATCAGAGG + Intronic
1195286526 X:103390426-103390448 GAAGATCAATAAGGAAACAGAGG + Intergenic
1195686885 X:107595595-107595617 GAATATCAACAAGGAAACAGAGG - Intronic
1195786069 X:108525031-108525053 GAAGATCAACAAGGAAATAGAGG - Intronic
1195840051 X:109165791-109165813 GAAAATTAATAAAGAAACATTGG - Intergenic
1195871650 X:109492730-109492752 TTATACTAATAAGGAAACGGAGG - Intergenic
1196182914 X:112714503-112714525 GAAGATTTGCAAGGAAACAGAGG - Intergenic
1196234658 X:113263987-113264009 GAAGATCAATAAGGAAACATAGG - Intergenic
1196239181 X:113320512-113320534 GAAAATCAATAAGGAAATAGTGG + Intergenic
1196262468 X:113599815-113599837 GAACATCAATAAGGAAACAGAGG + Intergenic
1196362361 X:114877996-114878018 GAAAATCAATAAGGAAACAGTGG - Intronic
1196695341 X:118605812-118605834 GAAAAGTAATAAGGAAACATTGG - Intronic
1196887259 X:120260128-120260150 GTAGATCACTTAGGAGACAGTGG - Exonic
1197294141 X:124696777-124696799 GTAGATTCATAAGTGAACAAAGG + Intronic
1197509930 X:127358412-127358434 GAAAATCAATAAGGAAACATTGG - Intergenic
1197676166 X:129333007-129333029 GTACATTAATAATGACACAAAGG - Intergenic
1197950489 X:131890767-131890789 GTAGTTCAATAAAGAGACAGTGG - Intergenic
1198168998 X:134086656-134086678 GTAGATTAACAAAGAAAAAGAGG + Intergenic
1198189880 X:134292115-134292137 GAAAATTAATAAGGAAACATTGG - Intergenic
1198294815 X:135276322-135276344 GTAGATGAATAAAGAAAATGTGG - Intronic
1198787737 X:140308521-140308543 GAAGATGAATAAGAAAACAGGGG + Intergenic
1199219545 X:145301521-145301543 GGAGATTTATAAAGAAAAAGAGG - Intergenic
1199564649 X:149202213-149202235 GAAGATCAATTAGGAAATAGAGG - Intergenic
1199749747 X:150804010-150804032 AAAAATCAATAAGGAAACAGCGG + Intronic
1200272666 X:154700694-154700716 ATAGATTAATGAGGAAACTTGGG + Intronic
1200733219 Y:6765486-6765508 GTAAATAAATAAACAAACAGTGG - Intergenic