ID: 1055545329

View in Genome Browser
Species Human (GRCh38)
Location 9:77365257-77365279
Sequence ATATAGAAGATAATGCTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 233}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055545329 Original CRISPR ATATAGAAGATAATGCTTGT TGG Intronic
904439294 1:30519670-30519692 ATGAAGAAGATAATGATTATGGG + Intergenic
905900944 1:41581662-41581684 AGAGAGAAGAAAATGCTTCTTGG - Exonic
905977526 1:42188047-42188069 ATAGAGAAGAGAGAGCTTGTTGG + Intronic
906713044 1:47946352-47946374 TTATATATGATATTGCTTGTAGG + Intronic
907625803 1:56028185-56028207 ATATAGAAGAAAATAATTGCGGG + Intergenic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
910398284 1:86813017-86813039 AAATACAAGATAATGCCTGCTGG - Intergenic
910593051 1:88948473-88948495 ATATAAAAAACAATGCTTTTTGG + Intronic
910663054 1:89694350-89694372 TTACAGAAGATAAGACTTGTGGG + Intronic
911206210 1:95093725-95093747 ACATAGAAGAGAATCCTGGTTGG - Intergenic
911861837 1:102961343-102961365 ATATATAAGATTGTGCTTATGGG + Intronic
912325221 1:108751433-108751455 ATATTTAAGTTAATGCTTTTGGG - Intronic
916018331 1:160770490-160770512 ATAGAGAAGCTAATGCCTGCTGG - Intergenic
917377972 1:174370936-174370958 ATATATAAAATAATGTTTGTTGG + Intronic
919113729 1:193254635-193254657 ATATAATAGATAATACTTGCAGG + Intergenic
923879922 1:238092440-238092462 ATATAGAAAAGAAAGCTTGGAGG + Intergenic
923894757 1:238257711-238257733 ATATAGAAGATAAACGTTTTAGG - Intergenic
924586245 1:245363532-245363554 ATAAAGAAGATACTGCTTTAAGG - Intronic
1063406427 10:5799974-5799996 ATATAGAAAAAAATCCTTTTTGG + Intronic
1063576153 10:7263605-7263627 ATTTAGCAGTTAATGTTTGTGGG - Intronic
1063629652 10:7721931-7721953 ACATAAAAGATAATGCTTAGCGG - Intronic
1064874606 10:19978957-19978979 ACATATAAGAAAATACTTGTAGG - Intronic
1064882487 10:20071763-20071785 AAAAAGGAGATCATGCTTGTTGG + Intronic
1065498945 10:26359616-26359638 ATATAGAAGATAAAACTATTTGG + Intergenic
1065500364 10:26375458-26375480 ATAAGGAAGATAAAACTTGTAGG + Intergenic
1065680993 10:28232488-28232510 ATATAGAAGAAAAAGCTTTATGG + Intronic
1066482539 10:35811022-35811044 ATATAGAAGATAGATCTTGCAGG + Intergenic
1066619257 10:37326561-37326583 ATAGAAAAGATAATGCTATTTGG + Intronic
1073017910 10:100416649-100416671 TTATATAGGAGAATGCTTGTTGG - Intergenic
1073906267 10:108284114-108284136 AGATAAAAGATAATAATTGTTGG - Intergenic
1075480960 10:122781281-122781303 ATATAATAGATAATGCCTTTTGG - Intergenic
1078078883 11:8188887-8188909 AAATAGAAGAAAATGCTTATTGG + Intergenic
1078260809 11:9706433-9706455 ATATACAAAATAATATTTGTAGG + Intronic
1078274709 11:9832436-9832458 ATAGAGAAGAGAATGATTGGGGG + Intronic
1078873106 11:15367340-15367362 ATAGTGAAGATGATGCTTTTGGG + Intergenic
1080882159 11:36332513-36332535 ATTTAGGAGATAATGGATGTAGG - Intronic
1082621964 11:55434026-55434048 AAACAGAAGATAATCCTTGGTGG + Intergenic
1084172606 11:67407765-67407787 ATATAGAACAGAATGCAGGTGGG - Intronic
1086364017 11:86089759-86089781 GTTTAGAAGAGAATGTTTGTGGG + Intergenic
1087846641 11:102980981-102981003 ATATAAAAGATAATGCAGGTTGG + Intergenic
1090570868 11:128043651-128043673 ATATGAAAAATAATGCTTTTGGG - Intergenic
1090810954 11:130242369-130242391 GTATATATGATAATGTTTGTGGG - Intronic
1093269751 12:17045580-17045602 ATACAAAAGATAAAGCTGGTAGG - Intergenic
1094194821 12:27737436-27737458 ATACAGAAGATAATGTTTTCAGG - Intronic
1094257922 12:28456344-28456366 ATTTAGCTGATAATGGTTGTAGG + Intronic
1095849827 12:46790112-46790134 AAATAGAAAATAATTATTGTAGG + Intronic
1098528283 12:71511763-71511785 AGGTAGGAGAAAATGCTTGTGGG - Intronic
1098854071 12:75632290-75632312 ATAATTAAGATAATGCTTATAGG - Intergenic
1099601143 12:84739371-84739393 ATATAGAATATTTTGCTTTTGGG - Intergenic
1102708761 12:114906631-114906653 TTATAGAGGATACTGCATGTAGG - Intergenic
1107652888 13:42562353-42562375 ATATTTAAGATGAGGCTTGTGGG - Intergenic
1107733392 13:43370872-43370894 ATATAGAAGCTACAGTTTGTGGG - Intronic
1108844769 13:54664166-54664188 ATATTGAAGATCAAGGTTGTAGG - Intergenic
1109085660 13:57968352-57968374 ATATAGCAAATAATACTTATAGG + Intergenic
1109133352 13:58615868-58615890 ATTTAGAAGAATAAGCTTGTAGG - Intergenic
1111027849 13:82555882-82555904 AAATAAAAGATAATACGTGTTGG + Intergenic
1111502338 13:89138151-89138173 ATAAAGAAAATATTTCTTGTGGG + Intergenic
1112740231 13:102464772-102464794 AAATAGAAGATAAAACTTATGGG + Intergenic
1113659083 13:112092351-112092373 ATATTGAAGTTAATGGTGGTAGG + Intergenic
1115094834 14:29622208-29622230 ACACAGAAGATAATGCTTTCTGG + Intronic
1116628666 14:47300426-47300448 ATATAGAAGATAATATGTTTAGG - Intronic
1116670738 14:47839376-47839398 ATATAGAAGATATTTTTTGGGGG + Intergenic
1117470255 14:56037446-56037468 AAATAGAAGATAAATCGTGTGGG - Intergenic
1117661084 14:58005698-58005720 AGAAAGATGAAAATGCTTGTGGG + Intronic
1117781922 14:59242229-59242251 ATAAAGAAAATAAAGCTTTTGGG - Intronic
1117805999 14:59491283-59491305 ATAGAGAAGACGATGCTGGTGGG + Intronic
1118301209 14:64618093-64618115 AAAGAGCAGATAATGCCTGTAGG + Intergenic
1118368717 14:65117580-65117602 AAATAGGAAATAATCCTTGTAGG - Intergenic
1120089056 14:80310034-80310056 ATAGAGAAGAAACTTCTTGTGGG - Intronic
1124932330 15:34133321-34133343 CTATACAAGATAATGGTGGTTGG + Intergenic
1126293901 15:47115322-47115344 ATGTAGAAGATAATGTGTGATGG - Intergenic
1127089281 15:55450733-55450755 ATATAGGAGATAAAGTATGTAGG - Intronic
1127608796 15:60616973-60616995 ATATAAAAGACAATGCATTTGGG + Intronic
1128987751 15:72233557-72233579 GTATAGAAGATCAAGCTTGGAGG + Intergenic
1129568146 15:76646910-76646932 GTAGTGAAGATAATGCTTTTAGG - Intronic
1129591566 15:76919679-76919701 ATATAGAAGATTGTGTCTGTAGG - Intergenic
1131846588 15:96495400-96495422 ATATCCAAGATACTGCTTGCGGG + Intergenic
1133594218 16:7274981-7275003 AATTAGAAGCTAATGCTTTTGGG - Intronic
1134890776 16:17839985-17840007 GTATGGAAGATGGTGCTTGTAGG - Intergenic
1135843723 16:25899337-25899359 AGATGGAAGTTAATGCCTGTTGG - Intronic
1139764558 16:69216123-69216145 GTATATAAGATAATACTTCTTGG + Intronic
1139785442 16:69388569-69388591 ATAAAGAAGAGAATGATTTTGGG + Intronic
1144224155 17:13128438-13128460 TTAAAGGAGATAATGCATGTAGG + Intergenic
1145285433 17:21502713-21502735 ATATAGAAAATATTTCTTGAAGG + Intergenic
1150324582 17:64246543-64246565 ATATTTAAGACAATGCTGGTAGG - Intronic
1150792477 17:68209560-68209582 TTATAGAAGAAAATAATTGTGGG + Intergenic
1153671927 18:7419737-7419759 ATAAAGAAGATACTTCCTGTGGG - Intergenic
1155326533 18:24670547-24670569 ATATAGAAGAAAGTCCCTGTAGG + Intergenic
1155425310 18:25700819-25700841 ATATTGAAGATAAGGCAAGTTGG - Intergenic
1156648914 18:39201010-39201032 ATATAGAAGAAAGTGCTTCCAGG - Intergenic
1158825133 18:61209806-61209828 ACAAAGAAGATAAAGCTTGTGGG + Intergenic
1158900284 18:61956041-61956063 ATTTAGGAGATAAAACTTGTAGG + Intergenic
1159209988 18:65306166-65306188 ATATAGAGGAAAATGATTTTTGG + Intergenic
1159634792 18:70791365-70791387 ATATAGAAAATAATGTTTTGTGG - Intergenic
1160071649 18:75634389-75634411 ATATATAATATAATGTTTGTAGG - Intergenic
1160153945 18:76418637-76418659 AAATAGAAGATTGTGCTTCTGGG + Intronic
1166595563 19:44045960-44045982 AAATAGAAAATAATACATGTTGG + Intergenic
1168555097 19:57331672-57331694 ATGTAGAAGATAAAATTTGTAGG - Intergenic
925970204 2:9101199-9101221 ATATAGAAGAAAATGCGGCTGGG + Intergenic
926554721 2:14342892-14342914 ACATAAAAGATAAAGCTTTTAGG + Intergenic
928213552 2:29342143-29342165 AAATAGAAAATAATGAGTGTTGG + Intronic
929396260 2:41526287-41526309 ACATGGAATATAATTCTTGTAGG - Intergenic
929682458 2:44005249-44005271 ATATTGAAGAGAATTCTTATTGG - Intergenic
932410008 2:71540822-71540844 ATGTAGTAAATAATTCTTGTTGG + Intronic
935553744 2:104484874-104484896 ATTTTGAAGATAAAGCTTGTAGG - Intergenic
935942910 2:108260148-108260170 TTGTAGAAGATATTACTTGTTGG - Intronic
936442306 2:112565322-112565344 ATACAGAAGATAAAGGATGTAGG - Intronic
941298125 2:163766239-163766261 ATATGAATGATAATGCTTTTAGG - Intergenic
941567659 2:167128953-167128975 GTATAGAATATAATGATTGAAGG + Intronic
942606058 2:177692332-177692354 CCATAAAAGATGATGCTTGTTGG - Intronic
943004328 2:182371256-182371278 AAATAGAAACTAATGCCTGTAGG - Intronic
944361325 2:198860778-198860800 ATACAGAAGATAATTCATGGTGG + Intergenic
944604422 2:201338320-201338342 ATATATAAGATTATGTTTTTCGG + Intronic
947275546 2:228387635-228387657 ATGTAGAAGAAAATGTCTGTGGG + Intergenic
947586287 2:231358893-231358915 ATATTGAAGATAGTCCTGGTTGG - Intronic
948970269 2:241420311-241420333 GTATAGTAGCTACTGCTTGTGGG + Intronic
1168791938 20:583781-583803 AAATAGAAGATATTTCTTGGTGG - Intergenic
1170528896 20:17269277-17269299 ATATAGAAGAGAAGATTTGTGGG + Intronic
1171020620 20:21581392-21581414 ATAAAGAAGAAAAGGTTTGTTGG + Intergenic
1174757219 20:53171524-53171546 ATTTAGAAGGTAATGCATTTAGG - Intronic
1174777085 20:53353493-53353515 ATGTAGAAGAAAATGCTTAATGG - Intronic
1183561390 22:38576944-38576966 ATATATAAAATAATCCTTTTGGG + Intergenic
949393486 3:3589443-3589465 GAATAGATGATGATGCTTGTTGG - Intergenic
951485600 3:23205356-23205378 ATTTAGAAGATAATGTTTAAAGG + Intronic
951620722 3:24599406-24599428 ATTTAGAAGATGACGCTTTTGGG - Intergenic
952623611 3:35376670-35376692 TTATAGAAGATAATCCTTTCTGG + Intergenic
954176953 3:48852278-48852300 ACATAGAAGCTGTTGCTTGTAGG - Intergenic
957392222 3:79591031-79591053 ATTTAGAAGATAACTCTGGTAGG + Intronic
957580445 3:82065790-82065812 ATATAAAAGATAATGGATGTTGG - Intergenic
957824787 3:85426599-85426621 ACACAAAAGATAATGCTTGAGGG - Intronic
958776261 3:98486880-98486902 AATTAGAAGATAAAGCTTGAAGG + Intergenic
960483460 3:118222262-118222284 ACATAGAAAATAATAATTGTTGG + Intergenic
961425498 3:126843028-126843050 ATATATAATATCATGCTTATTGG - Intronic
964489678 3:157222692-157222714 ATGTAGGAGAATATGCTTGTAGG - Intergenic
964910462 3:161774383-161774405 ATATAGAATATAAACCCTGTAGG - Intergenic
969243128 4:5915029-5915051 ATATTGAAGATAATATTTTTAGG - Intronic
969683559 4:8656579-8656601 ATATAGATGGTAATGCGTGCAGG - Intergenic
971850310 4:31977543-31977565 ATAAAGAAGATAGTGTTTGAAGG - Intergenic
973583420 4:52367542-52367564 ACAAAGAAGAAAATGCTTGATGG - Intergenic
973952853 4:56035233-56035255 ATAAAGAGGAGAATACTTGTTGG - Intergenic
974060686 4:57032070-57032092 ATTTAAAAGAAAATGATTGTGGG - Intronic
974532813 4:63132297-63132319 AAATAAAAGATACTGCTGGTTGG + Intergenic
974869946 4:67629166-67629188 ATTTAGAAGAATATGTTTGTTGG - Intronic
976372877 4:84310464-84310486 ATAGAGAATATAATGCATGCAGG + Intergenic
978084888 4:104639182-104639204 ATAAATAAGTTAATGCTTGGAGG - Intergenic
978399877 4:108320031-108320053 ATATAGAAGAAAGGACTTGTAGG + Intergenic
978637790 4:110830890-110830912 ATAGACAAAATAATGCTTGTGGG - Intergenic
979344441 4:119570358-119570380 ATATGGAAGCTAATGCTTTTAGG - Intronic
980621537 4:135312985-135313007 AGATAGAAGATAATGTTTACTGG - Intergenic
981014301 4:139957521-139957543 AAATACAGGATAATGCCTGTTGG + Intronic
981042016 4:140231937-140231959 ATTTAGAAGATAATACATGAAGG - Intergenic
981814459 4:148814436-148814458 ATTTAGAACATAATTCTTGGAGG + Intergenic
983050124 4:163036801-163036823 TTAGATAAGATAATGCTTATTGG + Intergenic
983297382 4:165883013-165883035 AGAAAGAAGATATTGATTGTAGG + Intronic
984306836 4:178003657-178003679 ATGTAGAAAATAATGTTGGTGGG - Intergenic
984452163 4:179915864-179915886 ATATAAAAGATTTTGATTGTTGG - Intergenic
984486262 4:180374351-180374373 ATCTAGAAGATGATTCCTGTGGG - Intergenic
986292919 5:6414759-6414781 GTATAGTAGATAATGCCCGTAGG - Intergenic
986792612 5:11177952-11177974 GTATATAAGATGATACTTGTTGG + Intronic
987894675 5:23928869-23928891 ATATAAAAAATAATACTAGTTGG + Intergenic
987951145 5:24677865-24677887 ATATAGAGGAGAATGTGTGTAGG + Intergenic
989690162 5:44132886-44132908 ATATAGAAGATAACAAGTGTTGG - Intergenic
990100522 5:52179890-52179912 ATATAGAATATAATTCTGTTAGG + Intergenic
990131016 5:52583136-52583158 AAATAGAAAATAAGGCCTGTGGG + Intergenic
990385219 5:55253807-55253829 CTTTAGAAGAGACTGCTTGTAGG + Intergenic
990696302 5:58421384-58421406 ACATAGAAAATAGTACTTGTAGG + Intergenic
993169838 5:84404615-84404637 CTCTAGAAGATAATGTATGTGGG + Intergenic
994595108 5:101822353-101822375 ATATAGAAGTAAATGCCTGTTGG - Intergenic
995133553 5:108656751-108656773 AAAATGAAGCTAATGCTTGTTGG - Intergenic
995335964 5:111000167-111000189 ATGTAACAGCTAATGCTTGTTGG - Intergenic
995617569 5:113983198-113983220 TTATACAAGATAATCATTGTTGG - Intergenic
996207064 5:120752610-120752632 ATATAGAAGTTAATAATTGTTGG - Intergenic
996791537 5:127298613-127298635 ATATGCATGATAATCCTTGTTGG + Intronic
997018751 5:129970724-129970746 ATAAAGAAGATATGACTTGTGGG + Intronic
998024602 5:138804490-138804512 AGACAGAAGGTAATGCTTGCTGG - Intronic
998920825 5:147065891-147065913 TTAAAGGAGATAATGCTTGTTGG - Intronic
999016802 5:148115713-148115735 GTAGAGAAGATAATGATTTTGGG + Intronic
999576835 5:152988244-152988266 ATTTAGAAGATAATGTCTGATGG + Intergenic
1000046333 5:157524665-157524687 AAAGAGAAGAGAAGGCTTGTAGG + Intronic
1000948277 5:167449129-167449151 ATGTAAAAGCTAAAGCTTGTAGG + Intronic
1001180542 5:169515969-169515991 ATACAGAAGATAATGTTAGTTGG - Intergenic
1003596470 6:7478604-7478626 ATGTAGAAGATTATACTGGTAGG + Intergenic
1006046099 6:31299952-31299974 ATATACAAGAAAATGTTTATGGG - Intronic
1008000114 6:46351533-46351555 AGCTAGAAGATAAAGCTTCTTGG - Intronic
1010081097 6:71863692-71863714 ATACAAAAGATAATGAGTGTTGG - Intergenic
1010813107 6:80322916-80322938 ATACAGCAGAGAATGCCTGTGGG + Intronic
1012392145 6:98754322-98754344 TTATAGATGAGAATGTTTGTGGG - Intergenic
1012884731 6:104832689-104832711 AAATAGAAAATAGTGCTTTTGGG - Intronic
1013394040 6:109716340-109716362 AAATAGCTGATGATGCTTGTAGG + Intronic
1014785767 6:125616980-125617002 ATATAGACGTCATTGCTTGTGGG - Intergenic
1017507616 6:155082931-155082953 AAATAGAAGAGAATGATTTTGGG - Intronic
1018177903 6:161194329-161194351 ATCTAAAAGATAAAGCTTCTTGG + Intronic
1018270038 6:162067384-162067406 ATGTAAAAGAAAATTCTTGTTGG - Intronic
1023452618 7:40303740-40303762 GTATGGAATATAATGCATGTAGG - Intronic
1024316435 7:48022788-48022810 ATATAGAAGAAAGTCTTTGTTGG + Intronic
1027348376 7:77285658-77285680 AAACTGAAAATAATGCTTGTTGG + Intronic
1027659308 7:80970133-80970155 ATATAGAAAATCAAACTTGTGGG - Intergenic
1027696321 7:81415546-81415568 ATATTGAAGTGAATCCTTGTTGG - Intergenic
1028040608 7:86048411-86048433 ATATCCAAGTTAATGCCTGTAGG + Intergenic
1028275119 7:88846188-88846210 ATATTGCAAATAATGCTTATTGG - Intronic
1028463645 7:91124186-91124208 ATATAAAAAAAAATGCTTGAAGG - Intronic
1028840496 7:95424490-95424512 ATGTATATGAAAATGCTTGTTGG - Intronic
1028894504 7:96026098-96026120 AAAAAGAAAATAATGCTGGTCGG - Intronic
1030456269 7:109778308-109778330 AAATAAAAAATAATACTTGTTGG + Intergenic
1032157961 7:129485367-129485389 ATATACAAGCTTATGCATGTGGG + Intronic
1033295869 7:140134737-140134759 ATCTAGATGATAAGGCTTATAGG + Intronic
1035146643 7:156824331-156824353 GTATAGAAGATAATTTTTGTAGG - Intronic
1035935024 8:3827079-3827101 ATAGAGAAGATATTGTTTCTAGG - Intronic
1036484769 8:9169654-9169676 ATATAGAAGAGAATGTGTATAGG + Intergenic
1037227943 8:16617892-16617914 ATAGAGAATATAATGTATGTAGG + Intergenic
1039082083 8:33743524-33743546 ATATTGAAGATATTTCTGGTAGG - Intergenic
1040030638 8:42820583-42820605 AAATAGAAAATAATACATGTTGG - Intergenic
1040354753 8:46606775-46606797 ATATACAAGAGAATGCTAGGTGG - Intergenic
1040494467 8:47954039-47954061 ATATAAAATATAAAGCTTTTAGG + Intronic
1042571936 8:70175126-70175148 ATCTAGAAAAAAATGCCTGTTGG - Intronic
1042578871 8:70254230-70254252 ATATAGAAAATAATAAGTGTTGG + Intronic
1042923776 8:73945661-73945683 TAATAGAAGATAATTCATGTAGG + Exonic
1043157912 8:76808740-76808762 TTATAGAACACAATGATTGTGGG - Intronic
1043832760 8:85009565-85009587 ATATAAAAATTAAAGCTTGTTGG + Intergenic
1044881005 8:96722240-96722262 ATATATAGGATAACTCTTGTGGG + Intronic
1047231747 8:123003519-123003541 ATATTGAACATCATGTTTGTGGG - Intergenic
1047878309 8:129165280-129165302 CTATGGAAGATAAAGCTTGTAGG + Intergenic
1048715340 8:137262520-137262542 ATACAGAACATACTGCTTTTTGG + Intergenic
1051081214 9:13296036-13296058 ATAATGAAAATAATGTTTGTCGG + Intergenic
1051157047 9:14159710-14159732 ATACAGAAGACAATACTTGAGGG + Intronic
1052374535 9:27703354-27703376 AGATAGAACATAATCCTTCTAGG - Intergenic
1052898995 9:33773938-33773960 AAATATCAGATAATGCTTTTAGG - Intronic
1054867580 9:70018270-70018292 CTTCTGAAGATAATGCTTGTTGG - Intergenic
1055270239 9:74549648-74549670 AGAGAGAAGAGACTGCTTGTAGG + Intronic
1055400210 9:75915428-75915450 AAATAGGAGAAAGTGCTTGTGGG + Intronic
1055545329 9:77365257-77365279 ATATAGAAGATAATGCTTGTTGG + Intronic
1056062266 9:82895964-82895986 GTATAAAAGATAATGGTTATGGG - Intergenic
1059614750 9:115937189-115937211 ATATAGAAGCTGATGCAGGTGGG + Intergenic
1060377661 9:123131795-123131817 TTCTAGAAGATAATCCTAGTAGG - Intronic
1185890612 X:3818663-3818685 ATAGAGAAGAAAAAGATTGTGGG + Intronic
1187373091 X:18726555-18726577 ATGGAGATGATGATGCTTGTGGG + Intronic
1188414062 X:29910386-29910408 AAAAAAAAAATAATGCTTGTAGG + Intronic
1188486076 X:30683947-30683969 ATATTGAAGATAATGCTAAAAGG - Intronic
1188607508 X:32050300-32050322 CTATAGAAAATTATGCTTTTAGG + Intronic
1189922417 X:45915466-45915488 AAAAAAAAGATAATGCTTGATGG + Intergenic
1192539364 X:71955182-71955204 ACATAGAAGATGAGGCTGGTAGG - Intergenic
1193075003 X:77346261-77346283 ACATAGAAGCTAAGGCTTGAAGG + Intergenic
1193141656 X:78034148-78034170 ATATAGAAAATTATGGTTCTTGG + Intronic
1194276952 X:91896952-91896974 AAATAGAAGAGAATGCATCTAGG - Intronic
1194410345 X:93550076-93550098 ATTTAAAAGATAATGTTAGTTGG - Intergenic
1195871225 X:109488577-109488599 ATATACAAGAAAATTCTTGGAGG + Intergenic
1196899802 X:120371529-120371551 TTATAGAAGATAATTCTTGGGGG + Intronic
1196949958 X:120867360-120867382 ATATAGAAAAGAAGGCTTCTTGG - Intergenic
1198614655 X:138443252-138443274 ACATAAAGGATAATGCTTGAGGG - Intergenic
1200594299 Y:5119051-5119073 AAATAGAAGAGAATGCATCTAGG - Intronic