ID: 1055547148

View in Genome Browser
Species Human (GRCh38)
Location 9:77390356-77390378
Sequence CTAGTTTAGCAGGAATCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055547145_1055547148 10 Left 1055547145 9:77390323-77390345 CCATGGATTTTTGGATACAATTA 0: 1
1: 0
2: 1
3: 18
4: 221
Right 1055547148 9:77390356-77390378 CTAGTTTAGCAGGAATCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055547148 Original CRISPR CTAGTTTAGCAGGAATCTCT TGG Intronic
No off target data available for this crispr