ID: 1055549339

View in Genome Browser
Species Human (GRCh38)
Location 9:77416462-77416484
Sequence TGGTATCAAGAGAACTTTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055549334_1055549339 14 Left 1055549334 9:77416425-77416447 CCCTGAGTGATGGGTAAGAAATC 0: 1
1: 0
2: 0
3: 14
4: 161
Right 1055549339 9:77416462-77416484 TGGTATCAAGAGAACTTTGGTGG 0: 1
1: 0
2: 2
3: 10
4: 152
1055549335_1055549339 13 Left 1055549335 9:77416426-77416448 CCTGAGTGATGGGTAAGAAATCA 0: 1
1: 0
2: 0
3: 13
4: 195
Right 1055549339 9:77416462-77416484 TGGTATCAAGAGAACTTTGGTGG 0: 1
1: 0
2: 2
3: 10
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055549339 Original CRISPR TGGTATCAAGAGAACTTTGG TGG Exonic
901908887 1:12438223-12438245 TGGTGTCAAGAGGTCATTGGGGG + Intronic
906959191 1:50405373-50405395 TGGCAACAAGAGAAAGTTGGTGG + Intergenic
907859852 1:58342276-58342298 TGGAATCTGGGGAACTTTGGAGG + Intronic
909105511 1:71401699-71401721 TGCAATCAACAGAATTTTGGGGG - Exonic
910736533 1:90464489-90464511 TGGTAACAAGGGAACTCTTGAGG - Intergenic
910785280 1:90990930-90990952 TGGCACCAGGAGAACTTTTGCGG + Intronic
918223822 1:182460387-182460409 TGGTATCAAGAGAAATATGCAGG + Intronic
923105579 1:230851163-230851185 GGGTATCAAAAGATCTTGGGGGG - Intronic
1062992040 10:1828468-1828490 TGGTGGTAAGAAAACTTTGGGGG + Intergenic
1068506733 10:57909751-57909773 TGGTTTCAAGAATACATTGGCGG - Intergenic
1069406290 10:68103043-68103065 TGGAATGAAGAGCAATTTGGAGG + Intergenic
1071187511 10:83061166-83061188 TGGTATCAGGAAAAATGTGGGGG - Intergenic
1071442518 10:85714909-85714931 TGGTATTCAGAGGACTTTTGTGG - Intronic
1071919771 10:90336381-90336403 TGGTATCCAGAGGGCATTGGAGG + Intergenic
1072852055 10:98906238-98906260 TGGCATGAAGGGAATTTTGGGGG - Intronic
1073283176 10:102369626-102369648 GGAAATCCAGAGAACTTTGGTGG + Intronic
1074616675 10:115076540-115076562 TGGGACCAGGAGAACCTTGGAGG + Intergenic
1079416077 11:20237871-20237893 TGGTTTTAAGGGAACATTGGTGG - Intergenic
1080596531 11:33778413-33778435 TGGTATAAATACAACTTGGGTGG - Intergenic
1083088087 11:60170683-60170705 TGGTATCCAGAGTGCTGTGGTGG + Intergenic
1085061338 11:73449822-73449844 TGGTAGACAGAGACCTTTGGAGG + Intronic
1085328903 11:75630645-75630667 TGGTACCCAGAGAAATTTGAAGG - Intronic
1085872899 11:80371394-80371416 GGGTTTCAGGAGAGCTTTGGAGG - Intergenic
1086501204 11:87455794-87455816 TGGTATCAAGAGAGCCATGTGGG - Intergenic
1086808832 11:91279289-91279311 TGGGATCAATAGAGCTTTGCAGG + Intergenic
1088318471 11:108531003-108531025 TGGTATCATGAAAACTATGCTGG + Intronic
1088612543 11:111591643-111591665 TAGAGTCAAGAGAAGTTTGGTGG - Intergenic
1090420533 11:126572252-126572274 TGGCCTCAAGAGAACTGTAGGGG - Intronic
1091076593 11:132623877-132623899 TAGAAACAAGAGAAATTTGGGGG + Intronic
1091358193 11:134954526-134954548 TGGTATCAGGGGAACCTGGGAGG - Intergenic
1093416569 12:18927332-18927354 AGTTATCAAGACAACTTTGTGGG - Intergenic
1093821511 12:23624698-23624720 GGAGATCAAGAGAATTTTGGGGG + Intronic
1095160907 12:38913891-38913913 TGGAATGAAGAGAAGATTGGAGG - Intergenic
1095248290 12:39947219-39947241 TCGGATAAAGAGAACTGTGGGGG - Intronic
1096212940 12:49780281-49780303 TGGGATCAAAGGAATTTTGGAGG - Intergenic
1096823136 12:54253055-54253077 GGGAATCAAGAGAATTTTGGGGG + Intronic
1102927632 12:116838770-116838792 TGGTATCAGGAGAAGAATGGAGG - Intronic
1104257892 12:127155803-127155825 TGGTATCAAGAATAATGTGGGGG - Intergenic
1109148765 13:58817355-58817377 TTGTATCAAGAAAACTTTCTTGG + Intergenic
1110146047 13:72191305-72191327 TAGCATTTAGAGAACTTTGGAGG - Intergenic
1115724733 14:36200785-36200807 TGGCACCAAGAGATATTTGGAGG - Intergenic
1115788160 14:36849277-36849299 TGATACGAAGAGGACTTTGGGGG + Intronic
1120650997 14:87132495-87132517 TGGTGTCAAGAGACCTCTGTAGG - Intergenic
1120816575 14:88865752-88865774 TGGTATCAAGTGATTTTTAGTGG - Intronic
1125033506 15:35096750-35096772 TGCTAACAAGGGAACTTTGCAGG + Intergenic
1125299375 15:38238181-38238203 TGGTGGCATGAGAAGTTTGGAGG + Intergenic
1126589008 15:50320566-50320588 TAGTATCTAGACATCTTTGGGGG - Intronic
1127222413 15:56893566-56893588 AGGTACCAACAGAAGTTTGGAGG - Intronic
1130102606 15:80905373-80905395 TGGAATAAAGAGATCTTAGGCGG - Intronic
1130568532 15:85019908-85019930 GGGTCTCTGGAGAACTTTGGGGG + Intronic
1130569037 15:85023969-85023991 TAGCATCAAGACATCTTTGGAGG - Intronic
1130852162 15:87805376-87805398 AGGGAGCAAGAGAACCTTGGTGG + Intergenic
1133868193 16:9663605-9663627 TGGCTTCATGACAACTTTGGTGG - Intergenic
1134178097 16:12024956-12024978 TGGTATTTAGAGAGTTTTGGTGG + Intronic
1134630309 16:15751497-15751519 TGGTAGAAAAAGAACCTTGGAGG - Intronic
1134909137 16:18008398-18008420 TGCTACCCAAAGAACTTTGGAGG - Intergenic
1137780093 16:51090607-51090629 AGGTATCAACAAAATTTTGGAGG + Intergenic
1139060046 16:63238984-63239006 AGGTATCAAGTGAATTTTAGTGG + Intergenic
1140281598 16:73559712-73559734 TGGAATAAAGAGGTCTTTGGCGG + Intergenic
1143053843 17:4148024-4148046 TGGTATGAAGAGCAGATTGGTGG + Intronic
1143399465 17:6633904-6633926 GGGCATCAAGAGAACTTTCTAGG + Intronic
1143470653 17:7173328-7173350 TGGCATCATGAGAACTGTGTGGG - Intergenic
1145741804 17:27281053-27281075 TGGCATTAGGAGAACTGTGGGGG + Intergenic
1145984938 17:29039412-29039434 TCTTATCAAGAGAAATCTGGGGG + Intronic
1147603130 17:41758288-41758310 AGGTATCAAGAGGTCTTTGGAGG - Intronic
1149526336 17:57358979-57359001 TGGCATCAAGAGACTTTTGTGGG - Intronic
1150758552 17:67938491-67938513 TGGTATCATGCTAATTTTGGTGG - Intronic
1151416158 17:73966630-73966652 TGGTTTAAGGAGAATTTTGGGGG - Intergenic
1151450239 17:74194308-74194330 TGCTGTCAGGAGCACTTTGGAGG - Intergenic
1152188832 17:78875848-78875870 TGGGATCCAGAGAGCATTGGTGG - Intronic
1154496750 18:14966713-14966735 TGGTATCAGGGGAACCTGGGGGG + Intergenic
1159654436 18:71014909-71014931 AGGTAGCAAGAGAACTTTGGAGG - Intergenic
1162039619 19:7962387-7962409 AGTTATGAAGAGAACTTTGAGGG + Exonic
1167024922 19:46908773-46908795 TGGAAGCATGAGAACTGTGGCGG + Intergenic
925635594 2:5938532-5938554 TGGAAACAAGAGCACTCTGGTGG + Intergenic
926787060 2:16528463-16528485 TGGTAGCAAGAGAAGTTCCGGGG - Intergenic
928535859 2:32240605-32240627 GTGAATCAAGAAAACTTTGGGGG - Intronic
929673307 2:43897463-43897485 TGGTATAAAAAGAACTTTTTGGG + Intronic
929895349 2:45955291-45955313 TGGTATAATGAGAAGTTTGGAGG + Intronic
931665080 2:64604627-64604649 TGGGATCTAGAGAAGGTTGGGGG - Intergenic
933133670 2:78703761-78703783 TTCTATCATGTGAACTTTGGGGG - Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
933353696 2:81189453-81189475 TGGTAACAACTGAATTTTGGAGG + Intergenic
933840980 2:86285343-86285365 TAGTATCAAGAAAACTGAGGGGG - Intronic
935171845 2:100616225-100616247 TGGTATAAAGAGAACTTCCCAGG + Intergenic
936233357 2:110723771-110723793 TGTTACCAATAGAACTTTGGAGG - Intergenic
937560608 2:123219318-123219340 GGGTCTCAAGGGAACATTGGTGG + Intergenic
938875045 2:135523350-135523372 TGGTATTAAGGGAAATTTAGAGG - Intronic
945045702 2:205779996-205780018 TGTCATCAAGAGAAATTTCGTGG - Intronic
945166378 2:206951293-206951315 TGCTATTAAGATAAGTTTGGTGG + Intronic
1170786813 20:19474299-19474321 TGGTATCCAGAGAATGGTGGAGG + Intronic
1172875204 20:38160011-38160033 TGTTAGCAAGAGAACTTTGGGGG + Intronic
1174459601 20:50673170-50673192 TGGTATCTAGAGAAGAGTGGAGG - Intronic
1175162577 20:57019992-57020014 TGGGATCAAGAGATCTTTAAGGG - Intergenic
1177315446 21:19454874-19454896 TGGGATCAATAGAATTTTTGTGG + Intergenic
1178000607 21:28158483-28158505 TGAAATCAAGAGAAGTTTAGGGG - Intergenic
1179386581 21:40948575-40948597 CGGTATCATGAGAACCTGGGAGG + Intergenic
1182228995 22:28822158-28822180 TGGCATCATGATAACTTTGAAGG + Intergenic
1182506623 22:30787829-30787851 GAGTATCAAAAGAACCTTGGAGG + Intronic
1182715157 22:32352473-32352495 TGTTATTAACAGAAGTTTGGGGG - Intergenic
1183720306 22:39558290-39558312 TGGCACCGAGAGAACTTTCGTGG - Intergenic
1184316198 22:43691889-43691911 TGCTAACAGGAGAACTGTGGGGG + Intronic
1184991212 22:48171271-48171293 TGGCATGAGGAGAACGTTGGTGG - Intergenic
949284437 3:2384351-2384373 TGGTAAGATGAGAACTTTGGTGG - Intronic
949567721 3:5260449-5260471 GGGTTTGAAGAGTACTTTGGTGG - Intergenic
952192000 3:31033496-31033518 TCGTATCATGAAAACTTGGGTGG + Intergenic
952348081 3:32507379-32507401 TGGCACCAAGAGAACCTTGGAGG + Intergenic
954091796 3:48290742-48290764 TGGCAACAAGAGAAAGTTGGTGG + Intronic
956664906 3:71632915-71632937 TGGTATGAAGTCAATTTTGGAGG + Intergenic
957139870 3:76340006-76340028 TGGTACCAGGGGAATTTTGGTGG - Intronic
958144242 3:89603299-89603321 TGGTATAAATAGAAATCTGGTGG + Intergenic
958664768 3:97122559-97122581 TGATACCAAGAGAACTTTATTGG - Intronic
959394432 3:105819634-105819656 TGATATCATCAGAACTTTGCAGG + Intronic
960120173 3:113941216-113941238 TGGTTTGATGAGAACTTTGAAGG + Intronic
960536380 3:118818988-118819010 TGATATCATGAGACATTTGGAGG + Intergenic
962586486 3:136847405-136847427 TGCAACCAAGAGAATTTTGGTGG + Intronic
962686662 3:137854587-137854609 TGGTTTCATGAGAATCTTGGAGG + Intergenic
964797917 3:160519875-160519897 TTGTATCAAAATAAATTTGGAGG + Intronic
964913650 3:161812881-161812903 TTATATCAACAGAACTTAGGGGG - Intergenic
966327244 3:178770917-178770939 TGGTATCAGGATTAATTTGGGGG + Intronic
969617083 4:8260009-8260031 TGGCCTCCAGAGAACTGTGGGGG - Intergenic
970158678 4:13167390-13167412 TGCATTCAAGAGAACTTTAGAGG - Intergenic
974261937 4:59536613-59536635 TGGCATCAAAATAACTTTTGCGG - Intergenic
977100422 4:92805591-92805613 AGAGATCAAGAGAACTTTAGAGG - Intronic
984240300 4:177210703-177210725 TGGGATCATGAGAAGTTTGGGGG - Intergenic
984816961 4:183847947-183847969 TGGTATAAAGAGAACTAGAGAGG + Intergenic
984849473 4:184141505-184141527 TGGTTTCATGACAACTTTGAGGG + Intronic
988204611 5:28117416-28117438 TGGTATCAAGGGAAGCTTGGTGG + Intergenic
988315422 5:29620475-29620497 TTTTATATAGAGAACTTTGGTGG + Intergenic
988582375 5:32479365-32479387 TGGTTTCCAGTGAACATTGGTGG + Intergenic
988923856 5:35969490-35969512 TGTTATCAGGTGTACTTTGGTGG - Intronic
994564281 5:101421592-101421614 TAGTATCAAAAAATCTTTGGAGG - Intergenic
1003285973 6:4734268-4734290 TGGGCTCAAGAGACCTTTGAGGG + Intronic
1003839059 6:10101540-10101562 TGGTATAAAGGAAACTTAGGAGG - Intronic
1007054953 6:38873883-38873905 TGCAATCAAGAAAACTTGGGAGG + Intronic
1009196044 6:60685877-60685899 TGGTATTAAGAGAAATTAGGAGG - Intergenic
1011884474 6:92076965-92076987 TGGTAACACCTGAACTTTGGAGG + Intergenic
1013805286 6:113989712-113989734 AGGTTCCAAGAGAACTTTGAAGG + Intronic
1013862822 6:114657512-114657534 TGGTATAAAGAGCAATGTGGAGG + Intergenic
1014765803 6:125405174-125405196 TGGAATGAAGACAACTTTGTTGG - Intergenic
1015543638 6:134340757-134340779 TGGTCTCATGAGACCTTTGCAGG - Intergenic
1017541413 6:155406849-155406871 TGCTTTCAAGACATCTTTGGTGG - Intronic
1019936515 7:4261731-4261753 GGGTATCAAGGGAACTGGGGAGG - Intronic
1021312216 7:19108925-19108947 TGATACCAAGAGCAGTTTGGTGG - Intronic
1022761426 7:33357937-33357959 TGGTATCAATAGTAATTTTGTGG - Exonic
1023268129 7:38430351-38430373 TGACATCAAGAGAACTCTGCAGG - Intronic
1032978661 7:137255250-137255272 TGGAAGCAAAAGAACTTTGAAGG + Intronic
1033516439 7:142111291-142111313 TTATACCAAGAGAACTCTGGAGG + Intergenic
1033965690 7:146972691-146972713 AGTTATAAAGAGAAGTTTGGAGG + Intronic
1038541946 8:28397225-28397247 GGTGATCAAGTGAACTTTGGGGG - Intronic
1043141397 8:76594153-76594175 TGGATTCAAGGGAACTTAGGTGG - Intergenic
1043310188 8:78849494-78849516 TTCTAACAAGTGAACTTTGGGGG - Intergenic
1043333118 8:79141645-79141667 TGGTGTCAAAAAAAATTTGGAGG + Intergenic
1044138417 8:88617194-88617216 TGGTATCCATGGAACTTTAGAGG + Intergenic
1051086725 9:13358769-13358791 GAGTATCATGAGATCTTTGGGGG - Intergenic
1055549339 9:77416462-77416484 TGGTATCAAGAGAACTTTGGTGG + Exonic
1055989536 9:82090846-82090868 CTGGATCAAGAGAACTGTGGTGG + Intergenic
1057277061 9:93681578-93681600 TGGAATCCAGCGAGCTTTGGAGG - Intergenic
1059134897 9:111795422-111795444 TGGTAGCAGAAGAACTTTTGAGG + Intergenic
1185600183 X:1333729-1333751 TGGTATTAAGAAAACCATGGCGG - Intergenic
1186818381 X:13260603-13260625 TGGTATCCGGAGAACTAAGGTGG - Intergenic
1196064102 X:111443742-111443764 TGGTTTCAAAACAAGTTTGGGGG + Intergenic
1197863494 X:130994946-130994968 TGGTCTCCAGACAAATTTGGGGG - Intergenic
1198443495 X:136688082-136688104 AGATAGCAAGAGAATTTTGGGGG + Intronic
1198622053 X:138523730-138523752 TAGAATCAACAGCACTTTGGGGG - Intergenic