ID: 1055550340

View in Genome Browser
Species Human (GRCh38)
Location 9:77427091-77427113
Sequence ATACATATCTACAACCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055550334_1055550340 30 Left 1055550334 9:77427038-77427060 CCAAGGAAATAAAATATATGAAA 0: 1
1: 1
2: 8
3: 127
4: 1221
Right 1055550340 9:77427091-77427113 ATACATATCTACAACCAGGAGGG No data
1055550337_1055550340 2 Left 1055550337 9:77427066-77427088 CCAGACAGTATACAGAGTGGATA 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1055550340 9:77427091-77427113 ATACATATCTACAACCAGGAGGG No data
1055550336_1055550340 3 Left 1055550336 9:77427065-77427087 CCCAGACAGTATACAGAGTGGAT 0: 1
1: 0
2: 2
3: 2
4: 92
Right 1055550340 9:77427091-77427113 ATACATATCTACAACCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055550340 Original CRISPR ATACATATCTACAACCAGGA GGG Intronic
No off target data available for this crispr