ID: 1055553794

View in Genome Browser
Species Human (GRCh38)
Location 9:77455451-77455473
Sequence GGGTGTGGGCAGGACAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 509}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055553794_1055553807 16 Left 1055553794 9:77455451-77455473 CCAACACTGTCCTGCCCACACCC 0: 1
1: 0
2: 5
3: 53
4: 509
Right 1055553807 9:77455490-77455512 TGCAGGACGTGTACACCAGGGGG No data
1055553794_1055553805 14 Left 1055553794 9:77455451-77455473 CCAACACTGTCCTGCCCACACCC 0: 1
1: 0
2: 5
3: 53
4: 509
Right 1055553805 9:77455488-77455510 TATGCAGGACGTGTACACCAGGG No data
1055553794_1055553804 13 Left 1055553794 9:77455451-77455473 CCAACACTGTCCTGCCCACACCC 0: 1
1: 0
2: 5
3: 53
4: 509
Right 1055553804 9:77455487-77455509 TTATGCAGGACGTGTACACCAGG No data
1055553794_1055553806 15 Left 1055553794 9:77455451-77455473 CCAACACTGTCCTGCCCACACCC 0: 1
1: 0
2: 5
3: 53
4: 509
Right 1055553806 9:77455489-77455511 ATGCAGGACGTGTACACCAGGGG No data
1055553794_1055553803 -1 Left 1055553794 9:77455451-77455473 CCAACACTGTCCTGCCCACACCC 0: 1
1: 0
2: 5
3: 53
4: 509
Right 1055553803 9:77455473-77455495 CAAAGGGGAAGAGATTATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055553794 Original CRISPR GGGTGTGGGCAGGACAGTGT TGG (reversed) Intronic
900329382 1:2126492-2126514 GGGGGTGGGCATGGCAGGGTCGG - Intronic
900358337 1:2275413-2275435 GGGTGTGGCCTGGCCGGTGTGGG + Intronic
900438104 1:2641012-2641034 GGGTGTGGGGAGGGCAGGGAAGG + Intronic
900494499 1:2970404-2970426 GGATGAGGGCAGGACAGAGCGGG + Intergenic
900598173 1:3491784-3491806 GGGTGCGGGCAGCAAAGTCTGGG + Intronic
900610382 1:3542148-3542170 GGGTGGGAGCAGCACAGTGTCGG + Intronic
900689970 1:3974607-3974629 GGGTGTGGCCAGAGCAGGGTGGG + Intergenic
900873063 1:5319041-5319063 GGGTGTGGTCTGCAGAGTGTGGG - Intergenic
901454436 1:9355015-9355037 GGGTGTGGGCAGGAAAAAGGTGG + Intronic
901632265 1:10653663-10653685 GGGGGTGGGCAGGCCCGAGTTGG + Exonic
902983044 1:20139243-20139265 GGCTGTGGGCAGGGCTGTGGGGG + Intergenic
903273224 1:22205027-22205049 AGATGTGAGCTGGACAGTGTGGG + Intergenic
903450828 1:23452632-23452654 AGGGGTGGGCAGGAGACTGTTGG - Intronic
903857559 1:26345844-26345866 AGGTCTGGGCAGCACAGTGGGGG - Exonic
903929401 1:26853755-26853777 GGGTGAGGGCAACACGGTGTCGG - Exonic
904143171 1:28369687-28369709 GGGAGCCGGCTGGACAGTGTAGG - Intronic
905024848 1:34843017-34843039 TGGTGTGGGGAGGAAAGTGGTGG - Intronic
905443055 1:38006536-38006558 GGGTGTGGGGAGGCCTCTGTGGG - Intergenic
905469500 1:38181267-38181289 AAGTGGGGGCAGGACAGAGTAGG - Intergenic
906030529 1:42716548-42716570 GGGTGTGGAAAGGACAGTGAGGG + Intergenic
906059010 1:42936371-42936393 GCTTGTGGGAAGGGCAGTGTGGG - Intronic
906104782 1:43285345-43285367 GGGGATGGGCAGATCAGTGTGGG - Intronic
906344992 1:45009538-45009560 GGCTCTGGGCAGGACAGGGTGGG - Intronic
907207658 1:52788114-52788136 GAGTGTAGGAAGGGCAGTGTAGG + Intronic
907314701 1:53560891-53560913 GGCTGTGGGCAGGGCGGGGTGGG - Intronic
907559209 1:55373282-55373304 GGGTGTGGTCATGAAAGTGAAGG + Intergenic
907954567 1:59215784-59215806 GGTGGTGGGGATGACAGTGTTGG - Intergenic
910088453 1:83432328-83432350 GGGTGAGGGAAGGGGAGTGTGGG + Intergenic
910136045 1:83971149-83971171 GGATATGGGCAGGACATTGAAGG + Intronic
910375593 1:86566296-86566318 AGGTATGCGCAGGACATTGTTGG - Intronic
910666298 1:89728835-89728857 GGGTGTGGTCAGGGAAGCGTGGG - Intronic
911059216 1:93733364-93733386 GACAGTGGGCAGGACAGTGGAGG + Intronic
911783520 1:101914275-101914297 GGGTGTGGGCAGTACACAGTAGG - Intronic
911857009 1:102891505-102891527 GCGGGGGGGCAGGACAGAGTTGG - Intronic
912419959 1:109536135-109536157 GGGTGTAGGCCAGACAGTGGGGG + Intergenic
912523766 1:110265726-110265748 GGAGGTGGGTAGGACAGGGTAGG + Intronic
912561876 1:110556756-110556778 GGGAGTGGGCAGCCCAGTGCTGG - Intergenic
912604365 1:110973308-110973330 GGGAGTGGGAAGGAGAGTGCAGG + Intergenic
915380399 1:155434390-155434412 GGGTGGGGGCAGGGGAGTTTGGG + Intronic
916166361 1:161970164-161970186 GGGTGGGGGCTGGAAAGTGCTGG + Intergenic
916168974 1:161986490-161986512 GGGTTTAGGCAGCTCAGTGTGGG + Intronic
916717601 1:167458292-167458314 TGGTGTGGGCAGGAATGAGTGGG + Intronic
917371788 1:174301124-174301146 GGGTGTGAGCAAGCAAGTGTGGG + Intronic
917414779 1:174797543-174797565 GGGTGTGTGCAGGAGGGTGTGGG + Intronic
918735275 1:188054066-188054088 CGGAGTGGGCAGAACAGGGTTGG - Intergenic
919907098 1:202085587-202085609 GGGTAGGGGCAGGGCAGTGCTGG + Intergenic
919914194 1:202129973-202129995 GGGTGGGGGCAGGCCAGGGCAGG - Exonic
920597069 1:207282684-207282706 GGGCGTGGACAGGGCAGGGTTGG + Intergenic
921232378 1:213086167-213086189 AGGTGTTGGAAGGACACTGTAGG + Intronic
922033292 1:221825031-221825053 TGTTGGGAGCAGGACAGTGTAGG + Intergenic
922034007 1:221830840-221830862 GGATATGGGAAGGACAGAGTGGG - Intergenic
922719593 1:227893505-227893527 GGGTGAGGGCAGGTCAGTGCTGG - Intergenic
923831194 1:237559370-237559392 TGGAGTGGGCAGAACAGAGTTGG + Intronic
1062904319 10:1169736-1169758 GGGTGTGGGGTGGCCACTGTAGG - Intergenic
1063622825 10:7665292-7665314 GTGTGGAGACAGGACAGTGTGGG - Intronic
1064213784 10:13382912-13382934 GGGTGTGGACAGGAGAATGTAGG + Intergenic
1065605613 10:27414335-27414357 GGGTGGGGCCAGGAGAGCGTTGG - Exonic
1065744890 10:28831579-28831601 GGGTGTGCACAGGACATTGTAGG - Intergenic
1065797238 10:29318862-29318884 GGGGGTGGGAAGGACAGAGGAGG + Intergenic
1065945918 10:30605471-30605493 GGGGGTGGGAAGGACAGAGGAGG - Intergenic
1066397783 10:35042891-35042913 GGGGGTGTGCAGGGCAGTCTTGG + Intronic
1066641024 10:37554167-37554189 GGCAGTGGGGAGGACAGGGTGGG + Intergenic
1066977817 10:42385609-42385631 GGGTGCGGGAAGGGCTGTGTAGG + Intergenic
1066996646 10:42570370-42570392 GAGGATGTGCAGGACAGTGTAGG - Intergenic
1067142540 10:43669109-43669131 GGGCAGGGGCAGGCCAGTGTGGG + Intergenic
1067164252 10:43852682-43852704 GGCTATGGGCAAGACAGTGCTGG + Intergenic
1067256434 10:44647341-44647363 GGGGGTGGGCAGGATGGGGTGGG - Intergenic
1067755686 10:49002567-49002589 CGGTGTGGGCTGGGCAGTGGTGG - Intergenic
1067832433 10:49617803-49617825 GGGGTTGGGCAGGGCAGTCTGGG + Intronic
1067975972 10:51025554-51025576 GGGTCTGAGCATGACAGAGTTGG - Intronic
1068550006 10:58396920-58396942 GGGTGCAGACAGGACAGTGTTGG + Exonic
1068717493 10:60204672-60204694 GTGTATGGGCCAGACAGTGTGGG + Intronic
1068774427 10:60855366-60855388 GGGTCTTGTAAGGACAGTGTAGG + Intergenic
1069397903 10:68010054-68010076 GGGTGGGGGCAGGGGAGTTTGGG - Intronic
1069666356 10:70162975-70162997 GGGTGGGGGCAGGACTGTGGAGG - Intronic
1071484334 10:86088610-86088632 GGTTGAGGGCAGGCCAGAGTGGG + Intronic
1071507325 10:86240597-86240619 GGGGGTGGGCAGGGCAGAGCTGG + Intronic
1074219417 10:111421617-111421639 GGGTGTGGGCTGAGGAGTGTGGG + Intergenic
1074897729 10:117791609-117791631 CTGTGTGGGCAGGAAAGTGGGGG - Intergenic
1076210793 10:128643092-128643114 AGGTGTGGGCAGGGCCGTGCTGG - Intergenic
1076266001 10:129110402-129110424 TGGTGAGGGCAGGCCAGTGATGG + Intergenic
1077022849 11:426918-426940 GGGGTTGGGGAGGACAGTGTGGG - Intronic
1077077034 11:706571-706593 GGGAGTGGGCAGGACGGGGCAGG - Intronic
1077188317 11:1245299-1245321 GGGTGAGGGCTGGACAGGGCTGG - Exonic
1077188849 11:1247399-1247421 GGGTGAGGGCTGGACAGGGCTGG - Exonic
1077189271 11:1249070-1249092 GGGTGAGGGCTGGACAGGGCTGG - Exonic
1077352677 11:2100120-2100142 GGGTGGGGGCGGGGCAGAGTGGG + Intergenic
1077390935 11:2300339-2300361 CGGGGTGGGCAGGAGGGTGTGGG + Intronic
1077554007 11:3217397-3217419 CGGGGTGGGCAGGACAATGATGG + Intergenic
1079125167 11:17713943-17713965 GGGTGGGGGCAGGGCACTATTGG - Intergenic
1079456090 11:20637331-20637353 GGGTGGGGGCAGGAGGGTGGGGG + Intronic
1079755683 11:24257980-24258002 TGGTTTGGTCAGGACAGTCTTGG - Intergenic
1080616512 11:33949233-33949255 GGGAGTGGGCAGGACATGGAGGG + Intergenic
1081793037 11:45802570-45802592 GCGTGTGTGGGGGACAGTGTGGG - Intergenic
1082679685 11:56152649-56152671 GGGAGTGGGCAGGATAGGGGCGG - Intergenic
1084256818 11:67948362-67948384 GGGTGTGTGCAGGGAAGTGCAGG - Intergenic
1084329550 11:68422724-68422746 GGGTAGGGGCAGGTGAGTGTGGG - Intronic
1084409156 11:68996591-68996613 GGGTGAAGGCAGGAGAGCGTGGG - Intergenic
1084666057 11:70576977-70576999 AGGGGTGGCCAGGACACTGTGGG + Intronic
1085334103 11:75678185-75678207 GAGTGTGGGCAAGTGAGTGTGGG + Intergenic
1085415342 11:76315790-76315812 TGTTTGGGGCAGGACAGTGTGGG - Intergenic
1085738151 11:79057249-79057271 GGGTGTGTGCAGGCCAGTGCAGG - Intronic
1088695527 11:112362778-112362800 GGGTGTGGGGAGGAGATAGTGGG - Intergenic
1088821344 11:113460319-113460341 GGGACTGGGCAGGACAGGGAGGG + Intronic
1089407074 11:118206673-118206695 GGGTGGGGGCAGGAGAGAGCAGG - Intronic
1090236865 11:125154693-125154715 GGGTGTGGTGGGGACAGTGGAGG + Intergenic
1090373986 11:126276316-126276338 GGGTGTGGGGTGGACAGGGTTGG + Intronic
1091211423 11:133864463-133864485 GGCTGTGGGCAGAACTGTGCTGG - Intergenic
1091237778 11:134033349-134033371 GGGGGTGTGGAGGGCAGTGTGGG - Intergenic
1091556137 12:1574731-1574753 GGATGTGGGCAGGAGGCTGTGGG + Intronic
1091645136 12:2267452-2267474 GGGTGTGGGCAGGACTGGGCAGG + Intronic
1091797254 12:3304389-3304411 CGGTGTGGGCAGGTCAGTGTTGG + Intergenic
1092208552 12:6631743-6631765 GGGTGTGTGGAGGAGAGTGAGGG - Intronic
1092262375 12:6959587-6959609 GGGAGCCGGCAGGACAGTGGTGG + Intronic
1092396659 12:8133621-8133643 GGGTGGGGGCAGGGGAGTTTGGG - Intronic
1092785033 12:12018760-12018782 GAGTGGAGGCAGGACACTGTGGG - Intergenic
1092830912 12:12443573-12443595 GGCTTTTGGCAGGACAGTGCTGG - Intronic
1093274735 12:17110524-17110546 TGGTGAGGGCATGACAATGTAGG + Intergenic
1093437308 12:19150386-19150408 GGGTGTGGGCAGAACAGGGGAGG - Intronic
1093766976 12:22975237-22975259 GGGAGTGGGGAGGGCAGGGTGGG - Intergenic
1094426146 12:30319220-30319242 GGGTCTGGGCAGGACCTGGTTGG - Intergenic
1095368414 12:41436617-41436639 GGGTGTGGATAAGTCAGTGTGGG + Intronic
1095539737 12:43295535-43295557 GGCTGTGGGAAGGACATTCTGGG - Intergenic
1096574530 12:52544462-52544484 GGCTGTGGGAAGTACAGTGTGGG + Exonic
1098202860 12:68075504-68075526 GGAGGTGGGGAGGACAGTCTGGG - Intergenic
1099452099 12:82820255-82820277 GGGTGTGTCTATGACAGTGTTGG - Intronic
1100307085 12:93360560-93360582 GGGGGTGGGAAGCACAGAGTAGG + Intergenic
1100519082 12:95356421-95356443 GGGGCTGGGGAGGACAGTGAGGG + Intergenic
1100757417 12:97766662-97766684 TGGTGTGGACAGGACATTGGAGG + Intergenic
1101083213 12:101209624-101209646 GGGGGTGCCCAGGACAGTGACGG + Exonic
1101324872 12:103706641-103706663 GGGTGGGGGCAGGACCCTCTGGG - Intronic
1101382213 12:104223912-104223934 GGGTGTGGGCAGAGTAGTGTGGG + Intronic
1101521225 12:105484198-105484220 GGCTGCCTGCAGGACAGTGTGGG + Intergenic
1101806323 12:108067387-108067409 GGGTGTGGGCAGTAAAGGGGTGG + Intergenic
1101844860 12:108355218-108355240 GGGTGTGTGCATCACAGTGAGGG - Intergenic
1103862270 12:124024820-124024842 GGGGTGGTGCAGGACAGTGTGGG + Intronic
1103953113 12:124562513-124562535 GGCTGTGGGGAGGACGGGGTGGG - Intronic
1104973079 12:132540316-132540338 GGCTGGGGGCAGGACTGGGTGGG - Intronic
1105439835 13:20405861-20405883 GGGTCGGGGCAGGCCAGTGCTGG - Intronic
1105453303 13:20519239-20519261 GGGTGTAGTCAGGAAAGTGAAGG + Intronic
1105474496 13:20718813-20718835 GAGTGTGGGCAGGTGTGTGTGGG - Intronic
1105607239 13:21936315-21936337 GTGTGTGTGCAGGAAAGTGTAGG + Intergenic
1105972740 13:25445729-25445751 GGGTGTGGGGAGGAGACTTTGGG + Intronic
1106757204 13:32834771-32834793 TGGTGTGGGCACAACAGTTTTGG - Intergenic
1110133775 13:72040501-72040523 GTGTGTGGGAAGGACAGGGAAGG - Intergenic
1110636212 13:77769291-77769313 GGGTTTGGGCAGCAGAGTATGGG + Intergenic
1110908573 13:80924728-80924750 TGTTCTGGGCAGGACAGAGTGGG - Intergenic
1113966144 13:114155073-114155095 GGGTGTGGGATGCAGAGTGTGGG + Intergenic
1113969781 13:114180102-114180124 AGGTGTGGGCAGAAGACTGTGGG - Intergenic
1115859235 14:37666135-37666157 GGGTGAGGGCAGGAATGAGTGGG + Intronic
1116617851 14:47161699-47161721 GGATGTGGGCAGCAGAGGGTGGG - Intronic
1117058878 14:51940446-51940468 GGGTGCGGGCAGGTGTGTGTAGG - Intronic
1117792051 14:59351454-59351476 GGGAGAGGGCAGGGCAGGGTAGG - Intronic
1118808140 14:69255374-69255396 GGGTCAGGGCGGGCCAGTGTAGG - Intergenic
1119616300 14:76101184-76101206 GGGGGTTGGCAGGAGAGTGGGGG - Intergenic
1119685286 14:76626311-76626333 GGGGAGGGGCAGGACAGGGTTGG - Intergenic
1121335854 14:93077086-93077108 GGCAGCGGGCAGGACTGTGTGGG - Intronic
1121783416 14:96637368-96637390 AAGTGTGGGCATGATAGTGTTGG - Intergenic
1121914957 14:97830321-97830343 TGGTGTGCCCAGGACAGTCTTGG + Intergenic
1122269024 14:100560075-100560097 TGGTGTGGGCAGGAGAGGGTGGG + Intronic
1122341349 14:101030486-101030508 GTGTGTGTGCAGGACAGGGCAGG + Intergenic
1122834132 14:104422908-104422930 GGCTCTGCGCTGGACAGTGTGGG + Intergenic
1122891970 14:104736176-104736198 CAGTGGGGCCAGGACAGTGTGGG + Intronic
1123107535 14:105849688-105849710 GGGTGTGCCCTGGGCAGTGTGGG + Intergenic
1124346215 15:28923225-28923247 GGGAGTGGGCAGGGCAGGGGCGG - Intronic
1124371292 15:29106286-29106308 TGGGGTGGGAAGGTCAGTGTTGG + Intronic
1124891780 15:33740423-33740445 GTGTGATGGCAGAACAGTGTGGG + Intronic
1126692215 15:51296369-51296391 AGGTGGGGGCATGACAGGGTTGG + Intronic
1127292508 15:57582957-57582979 GGCTTTGGGCAGAGCAGTGTGGG + Intergenic
1127377923 15:58402071-58402093 GGGTGAGGGCAGGGCAGGGAGGG + Intronic
1127499762 15:59544936-59544958 GGGTGAGGGCAGGGCACTGAGGG + Intergenic
1128061196 15:64736964-64736986 ACGTGTGGGCAGGGCAGGGTGGG + Intergenic
1128086728 15:64891790-64891812 GGGAGGGAGCAGGGCAGTGTGGG + Intronic
1128545114 15:68561383-68561405 GGGTGAGGGCAGGGGAGAGTCGG - Intergenic
1128943256 15:71805613-71805635 GGGGGTGGGCAGGAATTTGTGGG + Intronic
1129139677 15:73586124-73586146 GGGTGAGGGAAGGAAAGAGTGGG - Intronic
1129227693 15:74179554-74179576 GAGTGTGGGCAGCTCAGTGTGGG + Intronic
1129454955 15:75671820-75671842 CGGTGTGAGCAGGCCAGTGAGGG - Intergenic
1129785627 15:78308367-78308389 GGGTGAGGGCAGGACAATTATGG + Intergenic
1130295003 15:82640514-82640536 GGGAGTGGGAAGGACATTCTAGG - Intronic
1130551578 15:84893050-84893072 GGGTCTGGGCAGGCCAGGATGGG - Intronic
1130990447 15:88872832-88872854 AGGAGAGGGCAGGACAGTGCGGG - Intronic
1131293443 15:91127270-91127292 GGGTGTGGACAAGACAAGGTGGG + Intronic
1131463552 15:92637064-92637086 GGGTGTGGCCAGGCCCATGTGGG - Intronic
1132107638 15:99074770-99074792 GGGTATGGGCAGGGCACAGTTGG + Intergenic
1132142685 15:99408274-99408296 GGGAGTGGGCAGGAGGGAGTGGG - Intergenic
1133334920 16:5000785-5000807 GGGCCTGGGAAGGACTGTGTGGG + Intronic
1133730104 16:8571578-8571600 GGGTGGGGGCAGGGGAGGGTGGG - Intronic
1134021407 16:10923830-10923852 GGGTTTAGGCAGGACACTCTAGG - Intronic
1134807871 16:17141031-17141053 GGGTGTGTAGAGGACAATGTAGG + Intronic
1135976292 16:27110667-27110689 GGGTCTGGGCAGCAGACTGTAGG - Intergenic
1136233926 16:28903247-28903269 GGGAGTGGGCTGGGCAGTGCTGG + Intronic
1136365089 16:29806201-29806223 GGGTGTGGGCAGGGGGGTGGGGG - Intronic
1137401120 16:48155173-48155195 GGGTGTGGGAAGGGAAGTGGGGG + Intronic
1137748335 16:50840207-50840229 GAGGGTGTGCAGGCCAGTGTAGG + Intergenic
1138003841 16:53311386-53311408 GGGTGTGGGGATGACAGAGATGG + Intronic
1138049613 16:53762578-53762600 GAGGGTGGGGAGGAGAGTGTGGG + Intronic
1138515121 16:57531699-57531721 GGGGGTGGGCAGTGCAGTGGTGG - Intronic
1138536397 16:57662647-57662669 GTGTGTAGGAAGGACAGTGAGGG + Intronic
1138558738 16:57787713-57787735 GAGTGTGGGCAGGCCAGCCTCGG - Intronic
1139150933 16:64381250-64381272 GGCTGAGGGCAGCTCAGTGTGGG + Intergenic
1139341991 16:66273471-66273493 AGGTGTGGGCAAGGCAGGGTAGG - Intergenic
1141672227 16:85498087-85498109 GTGTGTGGGCAGGGCCGTGCTGG + Intergenic
1141712301 16:85707083-85707105 TGGTGTGTGCAGGCCATTGTGGG - Intronic
1141797606 16:86285661-86285683 AGGTGTGGACAGCACAGTGGTGG - Intergenic
1142168382 16:88605997-88606019 GTGTGTGCACAGGACACTGTTGG + Intronic
1142959432 17:3543286-3543308 GGGTTTGGGCAGGTGAGAGTCGG - Intronic
1143671356 17:8398092-8398114 GAGGGTGGGAAGGACAGTGTGGG - Intergenic
1144626536 17:16846934-16846956 GGTGGTGGGCAGGGCAGGGTGGG - Intergenic
1144696274 17:17305818-17305840 GGGAGTGGGGAGGAGAGGGTTGG + Intronic
1144758810 17:17695437-17695459 GGGTGGGGACAGGGCAGTGTTGG - Intronic
1144767801 17:17742228-17742250 GGGAGTGGACAGGCCAGGGTGGG - Intronic
1144879896 17:18425777-18425799 GGTGGTGGGCAGGGCAGGGTGGG + Intergenic
1145152337 17:20518607-20518629 GGTGGTGGGCAGGGCAGGGTGGG - Intergenic
1145268690 17:21392807-21392829 GGGTGTGGGCAGCACGGTCGGGG + Intronic
1145281193 17:21468240-21468262 GGGCGGGGGCAGGAAAGTGCTGG - Intergenic
1146407810 17:32554290-32554312 GTGTGGGGGCAGGAAAGGGTTGG + Intronic
1146943000 17:36856865-36856887 GGGGGTGGGCAGGTGGGTGTGGG - Intergenic
1147038677 17:37700747-37700769 GGGTTTGAAGAGGACAGTGTAGG - Intronic
1147580677 17:41625621-41625643 GGTGGTGGGCAGGGCAGGGTGGG - Intergenic
1147885740 17:43683297-43683319 GGTTGTGGGCAGGCCAGGGAAGG - Intergenic
1148542820 17:48493507-48493529 CGGTGTGGGGAGGCCAGCGTTGG + Intergenic
1150004010 17:61458335-61458357 GGGTGGGGGCAGGAGTGTGGAGG + Intronic
1150765186 17:67996506-67996528 GGGTGGGGGCAGCAAAGGGTGGG + Intergenic
1150944803 17:69733412-69733434 AGATGTGTGCCGGACAGTGTGGG + Intergenic
1151757701 17:76083964-76083986 GGCTGTGGGCAGCACAGGCTGGG + Intronic
1152069266 17:78127006-78127028 GGGGGTGGGCGGGACTGTCTGGG - Intronic
1152101043 17:78301869-78301891 GGGCGAGGGCAGGGCAGGGTGGG + Intergenic
1152361705 17:79835929-79835951 GGGTGTGGGCATCAAAGTGGGGG - Intronic
1152733419 17:81984830-81984852 GGGTGTGTGCAGGGGTGTGTGGG - Intronic
1152744361 17:82032113-82032135 GGGTGGCGGCAGGAGAGGGTGGG - Intronic
1152822079 17:82442488-82442510 GAGTGTGGGCAAGACACTGCTGG - Exonic
1153050877 18:902050-902072 TGCTGTGGGCAGGGCTGTGTGGG + Intergenic
1153585253 18:6614239-6614261 GCGTCTGGGCAGGACATTGCAGG + Intergenic
1153948416 18:10037041-10037063 CAGTGTGGGCAGTACATTGTAGG + Intergenic
1154017526 18:10632653-10632675 TGGTGTGGGCAGTACAGAGAGGG - Intergenic
1154035845 18:10800886-10800908 GGGCATAGGCAGGACAATGTTGG - Intronic
1154175709 18:12086529-12086551 GGGTGGGGCCAGGGCAGGGTAGG - Intergenic
1154187338 18:12196944-12196966 TGGTGTGGGCAGTACAGAGAGGG + Intergenic
1154234990 18:12596876-12596898 GGGGGTTAGCAGGACAGTGCAGG - Intronic
1154234999 18:12596917-12596939 GGGGGTTAGCAGGACAGTGCAGG - Intronic
1154411610 18:14144970-14144992 AGGTGTGGGCAGGCCTGTCTGGG + Intergenic
1155436319 18:25816431-25816453 GGGTGTGGGCAGGACGCTTAGGG + Intergenic
1156293698 18:35771790-35771812 AGCCCTGGGCAGGACAGTGTAGG + Intergenic
1156432839 18:37094033-37094055 GGGTGTGGGGAGGATGGTTTTGG + Intronic
1156816547 18:41318140-41318162 GGGTGTGGGGAGGCCAGTTAAGG - Intergenic
1157524704 18:48372059-48372081 GGGTGAGGGGAGGTCAGTGAAGG - Intronic
1157539648 18:48491212-48491234 GTGTGTGGGCAAGTCAGTTTAGG + Intergenic
1157693728 18:49704067-49704089 GGGAGTGGAGAGGAGAGTGTTGG - Intergenic
1158956198 18:62541546-62541568 GGGTGTGGGGGGTACACTGTTGG - Intronic
1160216380 18:76935985-76936007 AGGTCTGTGCAGCACAGTGTGGG + Intronic
1160489168 18:79322417-79322439 GGGTGCGGCCAGGAGAATGTCGG - Intronic
1160695572 19:482774-482796 GTAGGTGGGCAGGACAGTGCAGG - Intergenic
1160826303 19:1082082-1082104 GGGCCTGGGGAGGACAGGGTGGG + Intronic
1161288023 19:3478770-3478792 GGGTGGGGGCAGGGCTGTGGGGG + Intronic
1161570270 19:5026696-5026718 GGCTGGGGGCAGCACAGAGTGGG + Intronic
1161596690 19:5154281-5154303 GGGTGTGGGCAGGGGAGGGATGG + Intergenic
1161767881 19:6216936-6216958 GGGGGTGGGCAGGCCGGCGTAGG - Intronic
1161820701 19:6529176-6529198 GGGTGGGGGCAGGCCAGGGAAGG + Intergenic
1161920077 19:7259351-7259373 AGGGGTGGGCGGGGCAGTGTTGG + Intronic
1162774362 19:12969995-12970017 GGGTGTGGGGAGGAGAGGGCTGG + Intronic
1163091057 19:15020827-15020849 GAGTGTGGGCAGGAGAGTGCAGG - Intronic
1163640655 19:18460258-18460280 GGGGGTCAGCAGGACACTGTTGG - Intronic
1163672292 19:18636448-18636470 GGGTCTGGGCAGGAGAGAGGAGG - Intergenic
1163699534 19:18780472-18780494 GGCTCTGGGGAGGAGAGTGTTGG + Exonic
1163725526 19:18921294-18921316 GGGAGAGGCCAGGACAGAGTTGG + Intronic
1163752032 19:19083861-19083883 GGGTGTGGGCAGGTGTGTGCAGG - Intronic
1163768954 19:19179209-19179231 GGGTGTGGGCAGGGCTGCGTAGG + Intronic
1163830997 19:19547125-19547147 GGGTGTGGTCAGGACAGCGCCGG - Intergenic
1165040152 19:33063327-33063349 AGCCCTGGGCAGGACAGTGTGGG - Intronic
1166165072 19:40981831-40981853 CGTTGTGGGAAGGACACTGTGGG - Intergenic
1166381699 19:42358253-42358275 AGGTGCGGTCAGGACAGTGCAGG - Exonic
1166674647 19:44732565-44732587 GGGTGTGGGTGGGACAGAGCCGG + Intergenic
1166745211 19:45138610-45138632 AGGTATGGGCGGGACAGGGTGGG + Exonic
1166768274 19:45265318-45265340 GTGTGTGGGGAAGAGAGTGTAGG + Intronic
1166793782 19:45414042-45414064 GGGTGGAGGCAGGAGTGTGTCGG + Intronic
1166798880 19:45444044-45444066 GGGCCTGGGCAGGATAGTGGGGG - Intronic
1166979711 19:46625279-46625301 GGATGTGGGGAGGAGAGTGGAGG - Intergenic
1167158657 19:47754395-47754417 GGGTGTGGGGAGGAAAGCCTGGG + Intronic
1167211948 19:48139113-48139135 GGGTTCGGGCTGGTCAGTGTAGG - Intronic
1167323347 19:48809868-48809890 GGGTGTGGAGAGGACAGTGCTGG - Intronic
1167420102 19:49397738-49397760 GGGTGTGGGCAGGAGGGTCAGGG - Intronic
1168383084 19:55940791-55940813 GGGTGTGGGGAGGAAAGTGGGGG - Intergenic
924991822 2:319034-319056 GTGTGTGGGCACGTGAGTGTGGG + Intergenic
925107678 2:1306956-1306978 GGGTGTGAGCCGGGCATTGTGGG + Intronic
925337593 2:3109274-3109296 GGCTGTGGGATGGAGAGTGTGGG - Intergenic
925341586 2:3141731-3141753 GGGTGGGTGCAGGACGGTCTGGG - Intergenic
925584746 2:5453390-5453412 GGGTGTGAGGTGGACGGTGTGGG - Intergenic
925969846 2:9098653-9098675 GGGTGTGGGGAGGAGAGGGAAGG - Intergenic
926918318 2:17914757-17914779 GATTGTGGGCAGGACAGTGATGG + Intronic
927470893 2:23375802-23375824 GGGAGTGGACACGGCAGTGTTGG - Intergenic
927700943 2:25268603-25268625 GGCTGTGGGGAGGGCAGGGTAGG - Intronic
927949007 2:27154998-27155020 GAGTCTGAGCAGGACAGGGTGGG - Exonic
928200073 2:29242193-29242215 GGCAGTGAGCAGGACAGAGTTGG - Intronic
930342384 2:50133260-50133282 GGGTAAGGGCAGGACTGAGTTGG + Intronic
930752988 2:54949971-54949993 GGGTGTGGGCAGGGAACTGCAGG - Intronic
932476242 2:72008097-72008119 GTTTGTGTGCAGGACAGTGAAGG + Intergenic
932567193 2:72917547-72917569 GGGGCTGGGCAGGGCAGTGCGGG + Exonic
932644512 2:73487267-73487289 GTGTGTGGGCAAGCAAGTGTGGG + Intronic
933148016 2:78880228-78880250 GGGTAAGGGAAGGACATTGTTGG - Intergenic
934562649 2:95321016-95321038 GGGTGTGGGGAGGAGAGGCTGGG - Intronic
934562658 2:95321038-95321060 GGGTGTGGGGAGGAGAGGCTGGG - Intronic
934937117 2:98473439-98473461 GAGAGTGAGGAGGACAGTGTGGG + Intronic
935269760 2:101423795-101423817 CGGTGTGTGCAGCACTGTGTGGG - Intronic
937233999 2:120419424-120419446 GGCTCTGGGAAGGACAGTGCTGG - Intergenic
937804394 2:126121425-126121447 GGGTGTGTGCAAGCAAGTGTAGG - Intergenic
938135640 2:128754305-128754327 GGATGTGGGCAGGAGAGTCTGGG + Intergenic
938553378 2:132401162-132401184 CGGTGTGGGTAGGACAGAGTGGG + Intergenic
941997199 2:171611902-171611924 CAGCGTGGGCAGGACACTGTAGG - Intergenic
943023103 2:182598670-182598692 GTGTGGGGGCAGGGCAGAGTAGG + Intergenic
944538435 2:200733944-200733966 TGGTGAGGGAAGGACAGTGAGGG + Intergenic
946353036 2:219168164-219168186 GGGTCTGGGCAGGGCAGTAGAGG - Intronic
947096425 2:226572349-226572371 GGGTGGGGGCAGGGCCGTGGGGG - Intergenic
947125173 2:226861231-226861253 GAGTGTGTGCAGGAGAGAGTAGG + Intronic
947931198 2:233966538-233966560 GGGTGGAAGCAGGACAGTTTCGG + Intronic
948368541 2:237473786-237473808 GGGTCTGGGCAGGAGAGAGGTGG - Intergenic
948503994 2:238415581-238415603 GTGTGTGGGCAAGTGAGTGTGGG + Intergenic
948554275 2:238796503-238796525 GGGAGTGGGCAGGGCAGGGGTGG - Intergenic
948596788 2:239084542-239084564 GGGTGTGTGCATGTCCGTGTCGG - Intronic
948622437 2:239244802-239244824 GGGTGTGGGCCGCACAGTGGAGG - Intronic
949027570 2:241773697-241773719 GGGTGTGGGGAGGACAGACCAGG + Intergenic
949036340 2:241817227-241817249 GGGAGTGAGCAGGGCAGGGTGGG + Exonic
1168895363 20:1320117-1320139 GGGCCTGGGCAGGACAGAGCAGG + Intronic
1170218490 20:13916851-13916873 GGATGTGGGCAGGACAGTCTTGG + Intronic
1171211022 20:23316963-23316985 GGGTCTGGGCAAGGCAGAGTTGG - Intergenic
1172386088 20:34535096-34535118 GGGTGTGGCCAGGCCTGTCTGGG + Intronic
1173846593 20:46192551-46192573 GGGAGTGGGAAGGAGAGTGGGGG + Intronic
1173876880 20:46378507-46378529 GAGTGTAGGCAGGAATGTGTGGG + Intronic
1174169003 20:48604715-48604737 GGGTGTGGCCTGGAGAGTTTAGG - Intergenic
1174669278 20:52291441-52291463 GGGGGTGGGCAGGACAGGGCAGG + Intergenic
1175250775 20:57609125-57609147 AGGTGAGGACATGACAGTGTGGG - Intronic
1175291596 20:57879549-57879571 GGGTGTGGGCTGTGCAGGGTCGG - Intergenic
1175417828 20:58813196-58813218 GGGTGCAGGCAGGGCATTGTGGG - Intergenic
1176092544 20:63325534-63325556 GGGTGGGGGAAGGACAGGGATGG + Intronic
1176093249 20:63328295-63328317 GGGTGTCAGCAGGACACAGTGGG - Intronic
1176159246 20:63640292-63640314 GGGTGTGGGCAGGAGAGGCCTGG + Exonic
1176245486 20:64094818-64094840 TGGTGTGGGGGGGATAGTGTCGG + Intronic
1176245617 20:64095188-64095210 TGGTGTGGGGTGGATAGTGTGGG + Intronic
1179002335 21:37474109-37474131 GTGTGTGAGCAGGAGACTGTGGG + Intronic
1179404525 21:41114253-41114275 GGGTGATGGCAGGACAGCCTGGG - Intergenic
1180000640 21:44993866-44993888 AGGTGGGGACAGGACAGGGTTGG - Intergenic
1180791066 22:18575995-18576017 GTGGGTCGGCAGGCCAGTGTCGG - Intergenic
1181230670 22:21419319-21419341 GTGGGTCGGCAGGCCAGTGTCGG + Intronic
1181247978 22:21515550-21515572 GTGGGTCGGCAGGCCAGTGTCGG - Intergenic
1181694095 22:24584463-24584485 GGGTGAGGACAGGATGGTGTTGG - Intronic
1182086267 22:27563303-27563325 GGGTGAAGGCAGGGAAGTGTGGG + Intergenic
1182682912 22:32096413-32096435 GGGGCTGAGGAGGACAGTGTGGG - Intronic
1182842877 22:33406233-33406255 GGGTGTGGCCAGGCAAGTCTGGG - Intronic
1183538839 22:38418060-38418082 GGGGGTGGGCCTGACAGGGTAGG + Intergenic
1183893860 22:40951782-40951804 AGGTGGGGGAAGGACAGGGTAGG + Intronic
1184232823 22:43167796-43167818 GGGTCAGAGCAGGACAGTGATGG - Exonic
1184266013 22:43346496-43346518 GGAGGTGGGCAGGACGGAGTAGG - Intergenic
1184423109 22:44393131-44393153 CCCTGTGGGCAGGACAGTATTGG + Intergenic
1184643654 22:45884995-45885017 GGCTGTGGGCAGGGCAGTGTGGG + Intergenic
1184864113 22:47192982-47193004 GGGTGGGGGCTGGACAGAGCAGG - Intergenic
1185100842 22:48840173-48840195 GGGTGGGGGCAGGTTAGTGACGG - Intronic
1185299430 22:50071907-50071929 GAGGGTGGGCAGGACAGAGATGG + Intronic
1185333946 22:50263288-50263310 GGGTGGGGGCTGGGCAGGGTAGG - Intergenic
1185347561 22:50317093-50317115 GGGGGTGGCGAGGACAGGGTGGG + Intronic
950185216 3:10940497-10940519 GGGGGTGGGGAGGGCAATGTGGG + Exonic
950486486 3:13276877-13276899 GGGTGGGGGCAGCACACTGGAGG + Intergenic
950793776 3:15494267-15494289 AGGTGTGGGGAGGACAGGCTTGG + Intronic
950890465 3:16399976-16399998 GGGTGTGGTTAGGACCCTGTTGG - Intronic
950894297 3:16434082-16434104 GGGTTTGGGCAGGGCTGAGTGGG - Intronic
952298353 3:32081621-32081643 GGTTGTGGGAGGGACAGGGTGGG - Intergenic
953916739 3:46925224-46925246 GGGTGTGAGCAGGACTGAGAAGG + Intronic
953930824 3:47004898-47004920 GGGTGTGGGCAGGGCAGGGTGGG + Intronic
953979176 3:47405201-47405223 GGCTGTGGGGAGGTCAGTGGAGG - Intronic
954633950 3:52061444-52061466 GGGAGTGTGCAGGACAGTGAAGG + Intergenic
956467050 3:69529547-69529569 GGGTGTGGAGAGGAGAGAGTGGG - Intronic
956813318 3:72886085-72886107 GGGAGGGGGCAAGACAGAGTTGG + Intergenic
958538645 3:95438461-95438483 GAATGTGGGGAGGAGAGTGTGGG - Intergenic
958584512 3:96069217-96069239 GGCTGAGGGCAGCTCAGTGTGGG - Intergenic
959503311 3:107131515-107131537 GTGTGTGAGTGGGACAGTGTGGG + Intergenic
959813937 3:110652997-110653019 GTGTGTGAGCAAGACAGTGTGGG - Intergenic
959826079 3:110797305-110797327 AGGTGTGGGCAGAGCTGTGTAGG - Intergenic
960255848 3:115510685-115510707 GGGTGTGGAGAGGGCAGTGGGGG + Intergenic
961381968 3:126501036-126501058 GGCTGTGGGCAGGGCAGGGACGG + Intronic
961415914 3:126756555-126756577 TGGTGTGGGTATGACAGAGTAGG - Intronic
961465491 3:127078597-127078619 GGGTCTGGCCAGGCCAGTGCTGG + Intergenic
961531710 3:127544182-127544204 GGGTGGGGGCAGGCCAGGGAAGG + Intergenic
964090609 3:152872054-152872076 GGATGTGGGAAGGACAGTCCAGG + Intergenic
965418968 3:168432788-168432810 GCCTGAGGGCAGGACAGTATGGG - Intergenic
966439900 3:179933003-179933025 GGGTGTGGGCTGGAGGGAGTTGG - Intronic
967351663 3:188520498-188520520 TGTTGTGGGCAGGACCGTGTGGG - Intronic
967825472 3:193873887-193873909 GGGAGTGGGCAGGATAGGGGAGG + Intergenic
968037737 3:195562328-195562350 AGGTGTGGGCAGGGCTGTGAAGG - Intergenic
968150734 3:196335293-196335315 GGGTGGGGGCAGGAGAGGGCAGG + Intronic
968150773 3:196335396-196335418 GGGTGTGGGTAGGAGAGGGGAGG + Intronic
968150788 3:196335431-196335453 GGGTGTGGGTAGGAGAGGGGAGG + Intronic
968541307 4:1169729-1169751 GGGTGTGGGACAGTCAGTGTAGG - Intronic
968578812 4:1380258-1380280 GGGTGTGGGCTGGACCAGGTGGG + Intronic
968656108 4:1779128-1779150 GGGTGGGGGAAGGACACTGATGG - Intergenic
968916534 4:3499279-3499301 GGGGGTGGGGAGGTCACTGTGGG + Intronic
969313340 4:6366967-6366989 GGCTCTGGGCAGGACAGGGCGGG + Intronic
969497594 4:7534972-7534994 TGGGGTGGGCAGAACAATGTGGG - Intronic
969539902 4:7781738-7781760 GTCTGTGTGCAGGAGAGTGTTGG - Intronic
969720533 4:8891119-8891141 GTGGGTGGGGAGGACAGTGTTGG - Intergenic
971354205 4:25879704-25879726 GGGTGTGGGCAGGGCCTTGTGGG - Intronic
972367999 4:38393828-38393850 CAGTGGGAGCAGGACAGTGTGGG - Intergenic
972629833 4:40833421-40833443 GGGCGTGCGCTGGACAGTGTGGG - Intronic
973541791 4:51942144-51942166 GGGTGGGGGCAGGTCAGTCAGGG + Intergenic
973742352 4:53930394-53930416 GGGTGCTGGGAGGACAGTTTAGG - Intronic
975885233 4:78957138-78957160 TGGTGCTGGCAGGGCAGTGTGGG + Intergenic
976317461 4:83673789-83673811 GGGTGGGGGCAGGTCAGAGGAGG - Intergenic
976389191 4:84492473-84492495 GGGGGTGGGCAGGGCAGGGCAGG + Exonic
977785847 4:101034138-101034160 GGGTGCGAACAGGAGAGTGTGGG - Intronic
980098395 4:128517147-128517169 GGGGGTGGGGAGGACAGAGAAGG - Intergenic
981247661 4:142558649-142558671 GGGTGTTGGGGGGGCAGTGTGGG + Intronic
982113937 4:152081592-152081614 TGTTGTGGGAAGGACAGAGTGGG + Intergenic
982159679 4:152555059-152555081 GGATGTGGGCAGGGCACTGATGG + Intergenic
984501808 4:180566668-180566690 GGGTGTGTGTGGGTCAGTGTGGG + Intergenic
985095150 4:186406017-186406039 GCGTGTGGGCATGAGTGTGTGGG - Intergenic
985604282 5:850173-850195 GGGTCAGGACAGGACAGCGTTGG - Intronic
988484554 5:31657900-31657922 GGGTATGGGCTGGAAAGAGTAGG - Intronic
989182709 5:38594537-38594559 GGGAGTGGGGTGGACAGGGTGGG + Intronic
989269767 5:39518924-39518946 GGGTCAGGGAAGGACAGTTTTGG - Intergenic
989613002 5:43313281-43313303 GGGTGTGGGCCAGACAGAGGCGG - Intronic
989686228 5:44090347-44090369 GAGTGTGGGGTGGACAGTGGAGG + Intergenic
990538474 5:56748316-56748338 GGGAGTTGGCAGAGCAGTGTTGG - Intergenic
991134249 5:63162808-63162830 GGGAGTGGGGAGGACACTCTGGG + Intergenic
991478747 5:67053425-67053447 GGTTGAGGGCAGCACAGTGTAGG + Intronic
992549527 5:77847575-77847597 GGGTGGGGAGAGGACAGGGTTGG - Intronic
994180332 5:96757100-96757122 TGGGGTTTGCAGGACAGTGTGGG - Intronic
995181167 5:109231513-109231535 GGTTGAGGGCAAGACAGTTTAGG + Intergenic
997206645 5:132054104-132054126 GGGCCTGGGCAGGACAGAGCTGG - Intergenic
997250571 5:132385792-132385814 GCCTCAGGGCAGGACAGTGTAGG + Intronic
997364872 5:133319317-133319339 GGGAGTGGCCTGGACAGTGTGGG - Intronic
997661748 5:135594579-135594601 GGGAGGGGTCTGGACAGTGTTGG + Intergenic
997978503 5:138454325-138454347 GGGTCAGAGCAGGACAGTGCTGG - Intergenic
998126320 5:139625027-139625049 GGGTGGGGGCAGTGCAGTTTGGG - Intronic
999202231 5:149824663-149824685 GGTTCTGGGCTGGACAGGGTTGG + Intronic
999204437 5:149837920-149837942 GGGTGTGGGCCGGCCAGTGGAGG - Intronic
999762588 5:154713900-154713922 GGGTGTGGCCAGGAGAGTGATGG + Intronic
1001493673 5:172173189-172173211 GGTTGTGGGGAGGGCAGTGAGGG + Intronic
1001526142 5:172430277-172430299 GGGTGTGGGCTGGAGAGAGGTGG - Intronic
1001773778 5:174313886-174313908 GGATGTGGACAGCACAGTGAGGG + Intergenic
1002235873 5:177802532-177802554 GTGTCTGGGCAGAACAGAGTTGG + Intergenic
1002402208 5:178997013-178997035 GGGTTTGGGCAGGAAAGTGGAGG + Intergenic
1002491070 5:179577709-179577731 TGGTGTGGGCAGGGCAGGTTAGG + Intronic
1003926728 6:10883594-10883616 GGAGGTGCGCAGGACAATGTGGG + Intronic
1006028804 6:31164451-31164473 GGGTGGGGGCAGGGGAGTTTGGG - Exonic
1006076464 6:31535765-31535787 GGGCTTGGGCAGGAAAGGGTTGG - Intronic
1006131271 6:31870791-31870813 GGGGGTGGGCAGGACACTCACGG + Exonic
1006921805 6:37632478-37632500 GTGTGTTGGCAGGGCAGAGTGGG - Exonic
1007108225 6:39297796-39297818 GGGTGTGGGCATGGGAGTGAAGG + Intergenic
1007280561 6:40709341-40709363 AGGTGTAGACAGGACACTGTGGG - Intergenic
1007753126 6:44081929-44081951 CGTTGTGGGCAGGACCATGTGGG + Intergenic
1008660026 6:53658110-53658132 TGGTGTGGGCAGCCCAGTGCTGG + Intronic
1010176174 6:73030781-73030803 GGGTATTGGCAGGGTAGTGTTGG - Intronic
1011146610 6:84224752-84224774 GGGTGGGGGAAGGAGAGTGTTGG + Intronic
1011284214 6:85706383-85706405 GGCTGAGGGCAGCTCAGTGTGGG - Intergenic
1014030708 6:116700161-116700183 GTGTGTAGACAGCACAGTGTGGG + Intronic
1015275667 6:131381235-131381257 GGGTGTTGGCATGTCTGTGTTGG + Intergenic
1017604995 6:156124215-156124237 GGGTGGGGGCATGGCAGTGGCGG + Intergenic
1017649209 6:156565606-156565628 GGATGTGGGCAGGTAAGTGCCGG - Intergenic
1017798564 6:157870631-157870653 GTGTGAGAGCAGGAGAGTGTGGG - Intronic
1017798582 6:157870839-157870861 GTGTGAGAGCAGGAGAGTGTGGG - Intronic
1018080111 6:160252198-160252220 GGGTTTGGGTAGGAAAATGTGGG - Intronic
1018850948 6:167589677-167589699 GGATTTGGGCAGGGCTGTGTTGG - Intergenic
1018897396 6:168029825-168029847 GGGTGTGGTGAGCACTGTGTGGG - Intronic
1018903137 6:168061063-168061085 GGGAGTGGGGAGCACAGTGAGGG + Intronic
1019390904 7:786680-786702 GGGTGAGGGCAGGCCAGCCTTGG + Intergenic
1019390930 7:786748-786770 GGGTGAGGGCAGGCCAGCGTTGG + Intergenic
1019390963 7:786845-786867 GGGTGAGGGCAGGCCAGCCTTGG + Intergenic
1019407803 7:892969-892991 GGGTGTTTGCAGGTAAGTGTTGG + Intronic
1019407817 7:893029-893051 GCGTGTGTGCAGGTGAGTGTTGG + Intronic
1019407824 7:893064-893086 TGGTGTGTGCAGGCGAGTGTTGG + Intronic
1019407835 7:893131-893153 TGGTGTGTGCAGGTGAGTGTTGG + Intronic
1019407848 7:893201-893223 TGGTGTGTGCAGGTGAGTGTTGG + Intronic
1019407855 7:893236-893258 TGGTGTGTGCAGGTGAGTGTTGG + Intronic
1019407862 7:893271-893293 TGGTGTGTGCAGGTGAGTGTTGG + Intronic
1019407869 7:893306-893328 TGGTGTGTGCAGGTGAGTGTTGG + Intronic
1019407883 7:893373-893395 TGGTGTGTGCAGGTGAGTGTTGG + Intronic
1019407890 7:893408-893430 TGGTGTGTGCAGGTGAGTGTTGG + Intronic
1019407915 7:893539-893561 TGGTGTGTGCAGGTGAGTGTTGG + Intronic
1019407927 7:893603-893625 CGGTGTGTGCAGGTGAGTGTTGG + Intronic
1019407934 7:893638-893660 TGGTGTGTGCAGGTGAGTGTTGG + Intronic
1019433685 7:1011179-1011201 GGGTGTGGGTGGGTGAGTGTGGG - Intronic
1019476858 7:1248488-1248510 GCGTGTAGGCAGGGCAGTTTGGG + Intergenic
1019486305 7:1291003-1291025 GGGGGTGGGGGGGACACTGTAGG - Intergenic
1019525309 7:1477996-1478018 GGGTGTGGGCTAGCCAGGGTGGG + Intronic
1019701853 7:2477976-2477998 GGCTGGGGGCAGGACAGGGAGGG - Intergenic
1019981888 7:4627835-4627857 GGATTTGGGAAGGACAGTGGAGG - Intergenic
1020353444 7:7250655-7250677 GGGTGTGGGTAGGTGAGTGTGGG + Intergenic
1020394143 7:7694533-7694555 GAGTCTGGGAAGGACAGTGGTGG - Intronic
1021342601 7:19482835-19482857 GTGTGTTGGCAGGAAGGTGTGGG + Intergenic
1021388866 7:20067927-20067949 CAGTGAGGGCAGGACAGTGGGGG + Intergenic
1021579869 7:22141494-22141516 GGCTCTGGGCATGCCAGTGTAGG - Intronic
1022391848 7:29950367-29950389 GGCTGAGGGCAGCTCAGTGTGGG + Intronic
1022492753 7:30833466-30833488 TGTTGTGGGAAGGACACTGTGGG - Intronic
1022577614 7:31513584-31513606 GGCTGTGGGGAGGACATTGAAGG - Intergenic
1022989755 7:35695415-35695437 GGGTGCGGTCAAGACAGGGTAGG - Intronic
1023761567 7:43469170-43469192 GGGCGTGAGGAGGAGAGTGTGGG + Intronic
1023844577 7:44113515-44113537 GGCTGGGGGCAGGACTGAGTGGG + Intronic
1024291579 7:47808084-47808106 GGGAGTGGCCAGGACAGTGAAGG - Intronic
1024576369 7:50767786-50767808 AGGTGTGAGCAGCCCAGTGTAGG - Intronic
1024593578 7:50912800-50912822 GGGTGGGGGAAGGAAGGTGTGGG + Intergenic
1024973415 7:55091459-55091481 GGGTGTGGGGAGGCCACAGTTGG + Intronic
1026535118 7:71232810-71232832 GGGTGTGGCCATGGCAGTGGTGG + Intronic
1026978767 7:74514604-74514626 GGGTGGGGACCGGAGAGTGTTGG - Intronic
1027190503 7:75993497-75993519 GGCTGTGGCCAGGACAGCGGCGG + Intronic
1027305320 7:76888760-76888782 GGGTGAGGGAAGGGGAGTGTGGG + Intergenic
1029744520 7:102509558-102509580 GGGACTGGGCAGACCAGTGTGGG + Intronic
1029762511 7:102608720-102608742 GGGACTGGGCAGACCAGTGTGGG + Intronic
1029805542 7:102992145-102992167 GGGTGAGGGAAGAACAGTGAAGG + Intronic
1032198942 7:129805513-129805535 GGGGATGGGCAGGCCTGTGTAGG + Intergenic
1034424910 7:151009335-151009357 GGGTGGGGGCGGGAGAATGTGGG - Intronic
1034497985 7:151433409-151433431 TGGTGAGGGAAGGACAGGGTTGG - Intronic
1034994928 7:155571313-155571335 GGGTGGGGACAGGACGGGGTGGG - Intergenic
1035681010 8:1488183-1488205 GACTGTGTGGAGGACAGTGTGGG - Intergenic
1035726044 8:1824979-1825001 GGGTGTGGGGAGGACAGGTGGGG - Intronic
1035743924 8:1947928-1947950 GGGTGGGTGCAGGACTGTGTTGG - Intronic
1036392543 8:8336882-8336904 GGGTGTGGGGAGGGGAGTGGGGG - Intronic
1036813597 8:11885138-11885160 GAGTGAGGGCAGGGAAGTGTAGG - Intergenic
1036957992 8:13211535-13211557 GGGTGTGGGGAAGACAGAGAAGG + Intronic
1037489971 8:19388896-19388918 GGGGGAGGGCAGGACAGTCATGG + Intronic
1037628740 8:20632813-20632835 TGTTGTGGGAGGGACAGTGTGGG - Intergenic
1037931364 8:22882324-22882346 GGGTGTGGCCAGCACTGTCTGGG - Intronic
1041088350 8:54278604-54278626 GGGTGTGGGAATGAGTGTGTGGG - Intergenic
1044528713 8:93283043-93283065 GTCTGTGGGCTGGACAGTGGTGG + Intergenic
1044731063 8:95229054-95229076 GAGTGTGGGCAGGGCATTGATGG + Intergenic
1044744380 8:95357876-95357898 GGATGTGGGCAATTCAGTGTAGG + Intergenic
1047697473 8:127417073-127417095 GGGTGGGGGCAGGGGAGTTTGGG + Exonic
1047960745 8:130010057-130010079 AGGTGGGGGAAGGACAGTGAGGG - Intronic
1048920979 8:139229865-139229887 GGTTGTGGGGAGGACTGTGCTGG + Intergenic
1049017972 8:139934793-139934815 GGCTCTGGGCAGGACAGCGCTGG + Intronic
1049437663 8:142595153-142595175 GGGTGAGGGCAGGGAAGTGGTGG + Intergenic
1049438980 8:142600632-142600654 GGGTGTGGGCATGTCGGGGTGGG + Intergenic
1049615574 8:143574449-143574471 GGCTGGGGACAGGACAGGGTTGG - Intergenic
1049989640 9:978529-978551 GGGAGTTGGCAGGTCAGTGTAGG - Intronic
1050011237 9:1187599-1187621 CAGTGGGGGCAGGACAGTGGGGG - Intergenic
1051906307 9:22098809-22098831 AGGTGTGGTCAGCACAGTGTAGG - Intergenic
1053330408 9:37200971-37200993 GTGTGAGGGAAGGACAGTGGAGG + Intronic
1053525443 9:38825845-38825867 GGAGGAGGGCAGGGCAGTGTTGG + Intergenic
1054197672 9:62050272-62050294 GGAGGAGGGCAGGGCAGTGTTGG + Intergenic
1054640681 9:67538100-67538122 GGAGGAGGGCAGGGCAGTGTTGG - Intergenic
1055553794 9:77455451-77455473 GGGTGTGGGCAGGACAGTGTTGG - Intronic
1056163157 9:83918325-83918347 GGGGGGGGGCAGGACAGGGAGGG + Intronic
1056220275 9:84445028-84445050 AGGTGAGGTGAGGACAGTGTGGG + Intergenic
1056447475 9:86679661-86679683 GGGTGTGGGGGGGACAATGGGGG + Intergenic
1056999850 9:91497479-91497501 GGGCCTGGGGAGGACAGAGTGGG - Intergenic
1060044192 9:120327165-120327187 GATTGTGAGCAGGACAGTGATGG + Intergenic
1060549718 9:124479183-124479205 TGGCATCGGCAGGACAGTGTTGG - Intergenic
1061037991 9:128124022-128124044 AGGTGTGGGGAGGACAAAGTAGG + Intronic
1061848250 9:133400208-133400230 GGCTGTGGGCAGCACAGAGCAGG + Intronic
1062038576 9:134393644-134393666 GGGAGTAGGCATGACAGGGTGGG + Intronic
1062305412 9:135903874-135903896 GGGTTTTGGTAGGACAGTGTGGG - Intronic
1062490750 9:136803797-136803819 GCGTGTGGCCAGGGCAGTGGAGG + Intronic
1185594333 X:1297459-1297481 GGTTATGGGTAGGAGAGTGTAGG - Intronic
1187485888 X:19703057-19703079 GGGAGTGCTCAGGGCAGTGTGGG - Intronic
1187793100 X:22972130-22972152 GAGGCTGGGAAGGACAGTGTGGG + Intergenic
1189927653 X:45973452-45973474 GTGTGTGGGCAGGGGAGTATAGG - Intergenic
1190413692 X:50161797-50161819 TGGTGTGGGGAGGGCAGTCTTGG - Intergenic
1190913813 X:54795044-54795066 AGGTGGGAGCAGGACAGTGGTGG - Intronic
1191016496 X:55814549-55814571 GAGTGTGGGCAAGCAAGTGTGGG - Intergenic
1192184273 X:68936143-68936165 GTGTGTGTGCATGCCAGTGTGGG + Intergenic
1192261962 X:69510949-69510971 GAGTGGGGGCAGGTCAGGGTGGG - Intronic
1193247258 X:79243902-79243924 GGATGAGGGAGGGACAGTGTAGG - Intergenic
1193910957 X:87305891-87305913 GTGTTTGGGCAGGGCAGGGTAGG + Intergenic
1195494902 X:105519634-105519656 TGGTTTGGGTAGGACAGTTTGGG + Intronic
1196017012 X:110950075-110950097 GAGTGGGGGCTGGACATTGTGGG + Intronic
1197716115 X:129707136-129707158 GGGTGTGGGTGGGACTGTCTAGG - Intergenic
1197870614 X:131059300-131059322 GGGGGAGTGAAGGACAGTGTGGG - Intronic
1198932931 X:141879588-141879610 GGAGGTGGTCAGGAAAGTGTGGG + Intronic
1199092288 X:143705834-143705856 GGGAGTGGGCAGCACAGTGTTGG + Intergenic
1199827800 X:151516728-151516750 GTGTGTAGGCGGGACAGTGTGGG + Intergenic
1201013489 Y:9573812-9573834 GGGAGTGTGCAGGACAGTGCAGG - Intergenic