ID: 1055553798

View in Genome Browser
Species Human (GRCh38)
Location 9:77455461-77455483
Sequence CTTCCCCTTTGGGTGTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 6, 3: 35, 4: 306}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055553798_1055553806 5 Left 1055553798 9:77455461-77455483 CCTGCCCACACCCAAAGGGGAAG 0: 1
1: 0
2: 6
3: 35
4: 306
Right 1055553806 9:77455489-77455511 ATGCAGGACGTGTACACCAGGGG No data
1055553798_1055553807 6 Left 1055553798 9:77455461-77455483 CCTGCCCACACCCAAAGGGGAAG 0: 1
1: 0
2: 6
3: 35
4: 306
Right 1055553807 9:77455490-77455512 TGCAGGACGTGTACACCAGGGGG No data
1055553798_1055553804 3 Left 1055553798 9:77455461-77455483 CCTGCCCACACCCAAAGGGGAAG 0: 1
1: 0
2: 6
3: 35
4: 306
Right 1055553804 9:77455487-77455509 TTATGCAGGACGTGTACACCAGG No data
1055553798_1055553805 4 Left 1055553798 9:77455461-77455483 CCTGCCCACACCCAAAGGGGAAG 0: 1
1: 0
2: 6
3: 35
4: 306
Right 1055553805 9:77455488-77455510 TATGCAGGACGTGTACACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055553798 Original CRISPR CTTCCCCTTTGGGTGTGGGC AGG (reversed) Intronic
900612180 1:3548874-3548896 CTTTTCCTGTGGGTGTGGGGGGG - Intronic
900715250 1:4139931-4139953 TTTCCCCTTTGTGCGTGGGGGGG + Intergenic
901763006 1:11482712-11482734 CTCCACATTTGGGTGTGGGGAGG - Intronic
901900664 1:12359021-12359043 CTTCCCCTTTGCATCTAGGCAGG - Intronic
902107909 1:14052994-14053016 CCTGCCCCTTGAGTGTGGGCAGG + Intergenic
902944052 1:19821318-19821340 ATTCCCATTTTGGTGGGGGCGGG - Intergenic
903015155 1:20356741-20356763 CTGCACCTTTGGGGCTGGGCAGG - Intergenic
903225715 1:21893298-21893320 CTTCCCCATGGGGTGTTGACGGG - Intronic
903769785 1:25756651-25756673 CTTTCCCTCTGGGTGAGTGCGGG + Intronic
904471328 1:30738202-30738224 CTCTCCCCTTGAGTGTGGGCTGG + Intronic
904903133 1:33873386-33873408 CCCTCCCTTTGTGTGTGGGCTGG + Intronic
905276183 1:36819633-36819655 CTACCCCTAGAGGTGTGGGCTGG + Intronic
905879064 1:41451701-41451723 CTGCCCCTTTGACTGTGGCCAGG - Intergenic
906416023 1:45621943-45621965 CCTCCCCTTCGGTTGTAGGCTGG + Exonic
907308305 1:53525649-53525671 CTTCCCCTCTGGCTGTGTGTGGG - Intronic
907457145 1:54583040-54583062 CTTCCCGCTTGGTTGTGCGCTGG - Intronic
910268377 1:85365771-85365793 CTCCCCCTTTGAGTGTGAGTAGG + Intronic
912119098 1:106447552-106447574 CTTTCCCCTTGAGTATGGGCAGG + Intergenic
915269035 1:154739614-154739636 CTTTCCTTTTGAGTGTGGGCTGG + Intronic
917627426 1:176860225-176860247 CTCTCCCTTTGGATCTGGGCAGG - Intronic
918176541 1:182051260-182051282 CCTTCCCTTTTAGTGTGGGCTGG - Intergenic
919344753 1:196361241-196361263 CTTCCTCTGTTTGTGTGGGCAGG - Intronic
920387719 1:205580322-205580344 CTTCCCTTTAGGGTGTTAGCTGG + Intronic
922717424 1:227884817-227884839 CTTCCTCCTGCGGTGTGGGCGGG - Intergenic
924600320 1:245482989-245483011 CTTCCCCTTCAGGTGTGAGGAGG + Intronic
1065005164 10:21373028-21373050 CCCTCCCCTTGGGTGTGGGCTGG + Intergenic
1065144474 10:22754511-22754533 CTTCCCCTTTAGGAGGAGGCTGG + Intergenic
1065342572 10:24721964-24721986 CTTCCCCTTCGGGTGTGTGGTGG - Exonic
1065832542 10:29628251-29628273 TTTCCCATTTGGGTTTTGGCTGG + Intronic
1066673212 10:37861328-37861350 CTTTCCCCTTGAGTGTGGGCTGG - Intergenic
1067137209 10:43620787-43620809 CCTCCCCTTTGAGTTTGGACAGG - Intergenic
1068032355 10:51719230-51719252 CTTGCCCTTTGAGTGTGGGCAGG + Intronic
1070962624 10:80509670-80509692 CTTTCCCATTGGGATTGGGCAGG + Intronic
1072943875 10:99791936-99791958 CCTCTCCCTTGAGTGTGGGCTGG - Intronic
1073592348 10:104769265-104769287 CTTTTCCTCTGGCTGTGGGCTGG - Intronic
1074925514 10:118065927-118065949 CCCTCCCTTTGAGTGTGGGCAGG + Intergenic
1075316511 10:121457802-121457824 CTTCCCCTTTGGGGGGTTGCTGG - Intergenic
1076013947 10:127012942-127012964 CTTCCCCTTGGGCTGGAGGCGGG - Intronic
1076331882 10:129676104-129676126 CTCCCCATCTGGGTGTGGGACGG - Intronic
1076829450 10:132986641-132986663 CTTCCCCTGAGGGTGGGGACAGG + Intergenic
1078218114 11:9328937-9328959 CTTCTCCCTGGGCTGTGGGCAGG + Intergenic
1078399348 11:11010461-11010483 CTTGCCCTTAGGTTGGGGGCTGG + Intergenic
1079304603 11:19311268-19311290 TTACCCATTTGGGTGGGGGCGGG - Intergenic
1082013769 11:47469216-47469238 CTTCCCCTTGGGTTGTGACCAGG - Intronic
1083848743 11:65352859-65352881 CTTCCCCCTTGGCCGTGGGCAGG + Exonic
1084182167 11:67452264-67452286 CTGCCCCTCTGGGTCTGCGCCGG - Exonic
1086933362 11:92718010-92718032 ATGCCCCCTTGGGTCTGGGCTGG + Intronic
1087377944 11:97367818-97367840 CTTTCCCTTGGGTGGTGGGCAGG + Intergenic
1087463703 11:98477484-98477506 CTCCACCCTTGAGTGTGGGCTGG - Intergenic
1088687132 11:112294169-112294191 CTTCTCCAGTGGGTGTGTGCTGG + Intergenic
1089180228 11:116578510-116578532 CTGCCCATTTGGGTGTAGGACGG - Intergenic
1089630971 11:119783932-119783954 CTCCTCCCTTGAGTGTGGGCTGG + Intergenic
1089752398 11:120660950-120660972 CGCCCACTTTAGGTGTGGGCAGG + Intronic
1090040627 11:123287874-123287896 CCCTCCCTTTGAGTGTGGGCTGG - Intergenic
1090280077 11:125448331-125448353 TTTTCCCTTTGGGTGTTGCCAGG - Intronic
1090333463 11:125948104-125948126 CATTCCCTTTGTGTGTGTGCGGG + Intergenic
1090834051 11:130440932-130440954 CCTCCTCTTTGGGCATGGGCAGG + Intergenic
1091184647 11:133636773-133636795 CTTCCCCGGTGGGGGTGGGGGGG - Intergenic
1091891464 12:4058321-4058343 CTCTCCCTTTGAGTGTGGGCTGG - Intergenic
1091945432 12:4536747-4536769 TTTGCCTTTGGGGTGTGGGCCGG - Intronic
1094054162 12:26251586-26251608 CTTTTCCTTTAAGTGTGGGCAGG + Intronic
1095103074 12:38202948-38202970 CTGACACCTTGGGTGTGGGCAGG - Intergenic
1097264039 12:57735943-57735965 CTTTCCCTTGGGCTGTGGGGAGG - Intronic
1097908508 12:64944962-64944984 CATCCCCGTTGAGTGTGGGCTGG - Intergenic
1098032268 12:66267019-66267041 CTTCCCCTTCTGCTGTGGGTGGG + Intergenic
1100862168 12:98817854-98817876 CTTCCCCTGTGCCTGTGGGGAGG + Intronic
1100897963 12:99205729-99205751 CTTGACCTTTGGGTTTGTGCTGG + Intronic
1101561942 12:105864997-105865019 TTCTCCCTTTGAGTGTGGGCTGG - Intergenic
1102930147 12:116855945-116855967 CTTCCCTTCAGGGTTTGGGCGGG + Intergenic
1103623218 12:122201137-122201159 CCTTCCCTTTGGGGATGGGCTGG + Intronic
1104087589 12:125490771-125490793 CTTTCCTTTTGAGTGTAGGCAGG + Intronic
1104117794 12:125766351-125766373 CTTTCCCTTTGAGTATAGGCAGG - Intergenic
1104477450 12:129082301-129082323 CTCTCCCTTTGAGTGTGGGCTGG + Intronic
1106964053 13:35038268-35038290 GTTCCCCTTTGGCTCAGGGCAGG + Intronic
1107759450 13:43661354-43661376 CTTCCCCATAGGGTCTGGGTAGG + Intronic
1107806114 13:44155581-44155603 CTTCCCCTTTGCTTCTAGGCTGG + Intronic
1108530448 13:51323003-51323025 CTGCCCCTGTGGATCTGGGCAGG + Intergenic
1110979611 13:81879573-81879595 CTATCCCTTTGAGTGTGGACTGG - Intergenic
1112400950 13:99077840-99077862 CCTCTCCATTGAGTGTGGGCTGG - Intronic
1112641016 13:101275158-101275180 CTTCACCTTTGGGTGTTTTCTGG + Intronic
1113941041 13:114018726-114018748 CGTGGCCTGTGGGTGTGGGCAGG - Intronic
1114230258 14:20775017-20775039 CTACCCCTTTGGTTCTTGGCTGG + Intergenic
1114408348 14:22477089-22477111 TTTCTCCCTTGGGTCTGGGCTGG - Intergenic
1115509330 14:34124435-34124457 CTTCCCCTGTGGCTGCGGCCAGG + Intronic
1116619908 14:47188198-47188220 TTTTCCCTTTGAATGTGGGCTGG + Intronic
1117504985 14:56392853-56392875 CTTCCCTTCTGTGTGTGTGCAGG + Intergenic
1119158752 14:72435427-72435449 CTTCCCTGATGGGTGTGGTCAGG + Intronic
1120589442 14:86357991-86358013 CCACCACTCTGGGTGTGGGCAGG - Intergenic
1121222834 14:92299372-92299394 CTTCCCCTGTGGGGGTGGGAGGG + Intergenic
1121453061 14:94021730-94021752 CTTTTCCTTTGCGTGTGGGCTGG - Intergenic
1121985313 14:98499912-98499934 CTTCCCCTTCCTGTGTGGACAGG + Intergenic
1122109719 14:99490176-99490198 CTTTACCCTTGAGTGTGGGCTGG + Intronic
1122257412 14:100489017-100489039 CTGCCCCTGAGGTTGTGGGCAGG - Intronic
1122553100 14:102560730-102560752 CTTCCCCTTGGGGTCCGGCCTGG - Intergenic
1122999455 14:105284698-105284720 CTTCACCATTGAGTGTGGGTTGG - Intronic
1123017519 14:105382439-105382461 CTTCTCTTCTGGGTGTGGACAGG + Intronic
1123117516 14:105901368-105901390 GTTCCTCTCAGGGTGTGGGCTGG + Intergenic
1125241919 15:37585900-37585922 CTTCCCCTTCGGGACTAGGCCGG + Intergenic
1125748447 15:42012919-42012941 CTTCCCCTCTGGATGGGGCCAGG + Intronic
1126087761 15:45025183-45025205 TTTCACCTTTGGTTGTGTGCTGG + Intronic
1126961497 15:54001841-54001863 CATCCCCTGTGGGTGGGGGAAGG - Intergenic
1127342084 15:58057724-58057746 ATTCCCATTTGGGTGTGGAGTGG - Intronic
1127413413 15:58732097-58732119 CTTCCCCATTGGGAGGGGCCTGG - Intronic
1127489703 15:59450962-59450984 CTCTCCCTTTGAGTGTGGGTGGG - Intronic
1127526839 15:59801572-59801594 CTCTCCCTTTATGTGTGGGCTGG - Intergenic
1127572218 15:60254920-60254942 CACTCCCCTTGGGTGTGGGCAGG - Intergenic
1128334475 15:66777315-66777337 ATTCCCCGTGGGGTGTGGGGTGG + Intronic
1128578191 15:68790376-68790398 CAGCCCCTTGGGCTGTGGGCAGG - Intronic
1129187261 15:73916592-73916614 CCTTTCCTTTGTGTGTGGGCTGG - Intergenic
1129190939 15:73937263-73937285 CTTCCTCTGTGGGAGTGTGCAGG - Intronic
1130388656 15:83435388-83435410 CTTCCCCAGAGGGAGTGGGCAGG + Intergenic
1131002894 15:88952543-88952565 CTTCCTCTTTGGCAGTGGGGAGG - Intergenic
1131121977 15:89828480-89828502 CTCCCCAGCTGGGTGTGGGCTGG - Intergenic
1131375414 15:91919030-91919052 CCTTCCCTTTGGGTGTCAGCAGG + Intronic
1132551407 16:555315-555337 CTCCTCCTGTGGGTGGGGGCCGG + Intergenic
1132988853 16:2782848-2782870 CTGCCCTTTTGGGGGTGGGAGGG + Intergenic
1133588474 16:7218912-7218934 CTTCTCTCTTGGGTTTGGGCAGG + Intronic
1134537071 16:15034660-15034682 CTTCATCACTGGGTGTGGGCCGG + Intronic
1138595345 16:58026526-58026548 CCTGCCCTTTGGCTGCGGGCTGG + Intronic
1141217522 16:82038957-82038979 GTTCCCCCTTGGTTGTGGGCAGG + Intronic
1141636593 16:85317210-85317232 CACCTCCTTTGGGTGTGGACGGG + Intergenic
1143890865 17:10101462-10101484 CCTTCCCCTTGAGTGTGGGCGGG - Intronic
1144026657 17:11282783-11282805 CTGCCCCTCTGGGTTGGGGCTGG - Intronic
1145379165 17:22377642-22377664 GTTCCACTTTGGGTCTGTGCAGG + Intergenic
1145379643 17:22380012-22380034 GTTCCACTTTGGGTCTGTGCAGG + Intergenic
1145380122 17:22382387-22382409 GTTCCACTTTGGGTCTGTGCAGG + Intergenic
1145380602 17:22384734-22384756 GTTCCACTTTGGGTCTGTGCAGG + Intergenic
1145381080 17:22387109-22387131 GTTCCACTTTGGGTCTGTGCAGG + Intergenic
1145381563 17:22389462-22389484 GTTCCACTTTGGGTCTGTGCAGG + Intergenic
1145381682 17:22390155-22390177 GTTCCACTTTGGGTCTGTGCAGG + Intergenic
1145381816 17:22390884-22390906 GTTCCACTTTGGGTCTGTGCAGG + Intergenic
1145382290 17:22393248-22393270 GTTCCACTTTGGGTCTGTGCAGG + Intergenic
1145382767 17:22395627-22395649 GTTCCACTTTGGGTCTGTGCAGG + Intergenic
1145383143 17:22397434-22397456 GTTCCACTTTGGGTCTGTGCAGG + Intergenic
1145384094 17:22402104-22402126 GTTCCACTTTGGGTCTGTGCAGG + Intergenic
1145384891 17:22405935-22405957 GTTCCACTTTGGGTCTGTGCAGG + Intergenic
1145385018 17:22406565-22406587 GTTCCACTTTGGGTCTGTGCAGG + Intergenic
1146641097 17:34541966-34541988 CTTTCCCTTTGGGTATTGACTGG + Intergenic
1147240176 17:39085740-39085762 CTTACCATTTGGGTGTGGGAAGG - Intronic
1147953088 17:44117818-44117840 TTTCTCCTGTGGCTGTGGGCAGG - Intronic
1148028714 17:44605545-44605567 TTTCCCCTCTGGGTGAGGTCTGG - Intergenic
1148177965 17:45584447-45584469 TTTCCCCTCTGGGGGTCGGCGGG + Intergenic
1148612168 17:48971800-48971822 CTTCTCCTTATGGTGTGGACAGG - Intergenic
1149621209 17:58046730-58046752 AATCCACTCTGGGTGTGGGCTGG - Intergenic
1151301271 17:73228839-73228861 CTTTCTCTTTGGGTGTCGACTGG - Intronic
1152500837 17:80707960-80707982 CCTCCCCGTTGACTGTGGGCCGG - Exonic
1152750112 17:82058727-82058749 CTTCAGCTTTGGGGGTGGGCAGG - Intronic
1152889342 17:82871639-82871661 CTGCTCCTTTTGGTCTGGGCGGG + Intronic
1153077059 18:1175080-1175102 CTGCCCCTTGGGGAGAGGGCTGG + Intergenic
1153682552 18:7514299-7514321 CCTTCCCATTGAGTGTGGGCTGG - Intergenic
1153924557 18:9824696-9824718 CTTCCACTCTGGGAGTGGGGCGG - Intronic
1155240949 18:23863143-23863165 CCCTCCCTTTGAGTGTGGGCTGG - Intronic
1156281839 18:35646689-35646711 CTTCCTCCTAGAGTGTGGGCTGG - Intronic
1157743278 18:50112459-50112481 AGCCCCATTTGGGTGTGGGCAGG - Intronic
1158340491 18:56460767-56460789 CTTCCCCTTTCCTTGTGGGCAGG + Intergenic
1160400786 18:78609999-78610021 CTTCCCCCTGGGGTGGGGGCAGG - Intergenic
1160678401 19:402382-402404 CTTCCACGTGGGGTGTGGCCCGG - Intergenic
1161015454 19:1980746-1980768 CTTCCCCTTTGGTTTCGGGGAGG - Exonic
1161165552 19:2785434-2785456 CTCCTCCTTTAGCTGTGGGCGGG + Intergenic
1161719009 19:5892988-5893010 CTGCCCCTCTGGGTGCGGGGTGG + Exonic
1161756111 19:6135579-6135601 CTTCCCCTAGGGGTGGGGGTGGG + Intronic
1161774072 19:6248365-6248387 CCTCTCCCTTGAGTGTGGGCTGG + Intronic
1162048563 19:8017969-8017991 CCTCTCCTTTGTGTGTGGCCAGG + Intronic
1162181644 19:8873204-8873226 CTTCTCCACTGGGTGAGGGCAGG + Intronic
1162312370 19:9914606-9914628 CTTTAACTTTGGGTGGGGGCGGG + Intronic
1163467101 19:17474588-17474610 CCCTCCCTTTGAGTGTGGGCTGG + Intronic
1163514459 19:17754690-17754712 CTTCCCCTCTGGGGGAGGGGAGG + Intronic
1163530025 19:17843463-17843485 CTTCCCCAATTGGTTTGGGCTGG - Exonic
1165135719 19:33667174-33667196 CATCCCCTTTGCCTGTGTGCTGG + Intronic
1167000809 19:46745262-46745284 GTTCCACTTTGGGGGTGTGCAGG - Intronic
1168116620 19:54224465-54224487 CCTCCCCTGTGTGTGTGGACAGG + Intronic
1168119603 19:54244248-54244270 CCTCCCCTGTGTGTGTGGACAGG + Intronic
1168168617 19:54572177-54572199 CCTCCCCTGTGTGTGTGGACAGG - Intergenic
1168184985 19:54694899-54694921 CCTCCCCTGTGTGTGTGGACAGG - Intronic
926078885 2:9967266-9967288 CTTCTTCGTTGGGTGTGGTCAGG + Intronic
926087223 2:10028092-10028114 CTTTCCCTGTGGCTGTGGGCTGG - Intergenic
926900418 2:17745500-17745522 CTTACCCTTTGGATGTCTGCAGG + Intronic
927823777 2:26292797-26292819 CCCCCGCTTTGAGTGTGGGCTGG + Intergenic
931628330 2:64276925-64276947 CTTCCCCTTTGTGTGAGTCCAGG - Intergenic
932336201 2:70932750-70932772 CTTCACCTTGGGGTGGGGGAGGG - Exonic
933183322 2:79251454-79251476 CTTTCCCTTTAAGTATGGGCTGG + Intronic
933374238 2:81459090-81459112 CAGTCCCTTTGTGTGTGGGCTGG + Intergenic
934111768 2:88750114-88750136 CGTCCACCTTGGCTGTGGGCTGG - Exonic
935683939 2:105667206-105667228 CTTCCCCCTTGAGGGTAGGCAGG - Intergenic
937440599 2:121912239-121912261 CCTTCTCCTTGGGTGTGGGCTGG + Intergenic
937860690 2:126706653-126706675 CCACCCCCTTGGGCGTGGGCTGG - Intergenic
941664425 2:168230230-168230252 CTTTCCCTTTGAATTTGGGCTGG + Intronic
942247565 2:174021922-174021944 CTTTCCCCTTGAGTATGGGCTGG + Intergenic
945354996 2:208829833-208829855 CTTTCCCTCTGGGTATGAGCAGG - Intronic
946102340 2:217336601-217336623 CATACCCTTTGTGTGGGGGCAGG + Intronic
946676674 2:222167834-222167856 CTCTCCTTTTGAGTGTGGGCAGG - Intergenic
948285908 2:236785040-236785062 CTTTCCGTTTGATTGTGGGCTGG + Intergenic
948674041 2:239586808-239586830 CTTCCCTCTGGTGTGTGGGCTGG - Intergenic
948914801 2:241029055-241029077 CTTCCCCTTTGGGTGAAGCCTGG - Intronic
1169228359 20:3870225-3870247 CTTCACCTTGGGGTGAAGGCTGG + Exonic
1169445681 20:5669343-5669365 CTTTCCCTTTGCCTGAGGGCAGG + Intergenic
1169665279 20:8027504-8027526 CACTCCCTTTGCGTGTGGGCAGG + Intergenic
1172835370 20:37869858-37869880 TTTCCTCTCTGGCTGTGGGCAGG + Intronic
1173129362 20:40374518-40374540 CTTTCCCCTTGAGTGTGAGCAGG + Intergenic
1173575118 20:44108037-44108059 CCTGACCTTTGGGTGTGGGGAGG + Intergenic
1174581495 20:51575168-51575190 CTTTGCCTTTGAATGTGGGCTGG - Intergenic
1174588729 20:51628380-51628402 CCTACCCTTTGAGTGTGTGCTGG + Intronic
1175140932 20:56859903-56859925 ATTCCCCTCGGGGTGGGGGCGGG + Intergenic
1177114998 21:17074443-17074465 CATACCCTTTGAGTGTGAGCTGG - Intergenic
1177144072 21:17388608-17388630 CTTTCCCTTTGAATATGGGCTGG - Intergenic
1178661315 21:34510095-34510117 CTCTCCCCTTGAGTGTGGGCAGG - Intergenic
1178751745 21:35311236-35311258 CTGCCCCTTTGAGTGTGGGCTGG - Intronic
1179036094 21:37759799-37759821 CTCTCCTTTTGAGTGTGGGCTGG + Intronic
1179067535 21:38040071-38040093 CCTCCCCTTTGAGTCTGGGTGGG + Intronic
1179983819 21:44910415-44910437 ACTCCCCCTTGGGTGTGGGCAGG - Intronic
1181311180 22:21945815-21945837 CGTCCCCTTTGGGGGTGCACAGG + Intronic
1181623566 22:24107071-24107093 CTGCCCCCTTGGTAGTGGGCGGG + Intronic
1182661744 22:31929935-31929957 CTTGCCCTTTGGATCTGGGCTGG - Intergenic
1183025091 22:35058818-35058840 CCTCCCCTTTCGGAGTTGGCAGG - Intergenic
1183358438 22:37371474-37371496 CTTCACCTCTGGGTGGGAGCTGG - Exonic
1184164001 22:42716802-42716824 CTTCCCCTTCAGGTGGGGGTAGG - Intronic
1184364814 22:44043832-44043854 TTTCACCTTGGGGTGAGGGCGGG + Intronic
1185156125 22:49194525-49194547 CTTCCTGTGTGGGTGTGGGCAGG - Intergenic
949561355 3:5205639-5205661 GTTCCTCTTTGGCTGTTGGCTGG + Intronic
949862133 3:8515589-8515611 CTTCCCCTTTGGGTGTGCCCTGG + Intronic
954714506 3:52520447-52520469 CTTGCCCTTTGAGGGTGGCCTGG + Exonic
955793935 3:62615720-62615742 ATTCCTCTGTGGGTGTGGGTGGG - Intronic
956295880 3:67713339-67713361 CTCTCCCTTTGAGTGTGGGCTGG + Intergenic
956746547 3:72315400-72315422 CTTCCCTTTTTGCTGGGGGCAGG - Intergenic
956904783 3:73754572-73754594 CTTCCCTCCTGAGTGTGGGCTGG + Intergenic
957122388 3:76111723-76111745 CTGCCCTTTTGGGTGGAGGCAGG - Intronic
959104223 3:102048005-102048027 CCTACCCCTTGGGTGTGGGTAGG - Intergenic
959121862 3:102242176-102242198 CTCTCCCTTTGGCTTTGGGCAGG + Intronic
961464113 3:127071167-127071189 CGTGCCCTTTGGATGTGGGCAGG - Intergenic
961826267 3:129600749-129600771 CTTTACATTTGGGTTTGGGCTGG - Intronic
962746215 3:138398963-138398985 CCTCCCCTCTGGGTGTGTGCAGG + Intronic
964493290 3:157260197-157260219 CTCCCCCATTGAGTGTGGGTGGG - Exonic
965031259 3:163371096-163371118 CCTTCCCCTTGAGTGTGGGCAGG + Intergenic
966088722 3:176103990-176104012 CTTTCCCTTTGAGTGTGGGCTGG - Intergenic
966348211 3:179001782-179001804 CTTAACCTTTGGGTGTTGGATGG + Intergenic
967001679 3:185341646-185341668 CTCTCCCCTTGGGTGTGGGCTGG + Intronic
967041286 3:185695185-185695207 CTTCACCTTTGGGCATGGGCAGG + Intronic
968005848 3:195242250-195242272 CTCTCTCTTTGGGTGAGGGCTGG - Intronic
969357554 4:6639336-6639358 CTCCACCTTGGGGTGTGGGGAGG + Intergenic
969511855 4:7622593-7622615 CTTCCTCTTTGCCTGTGGGAGGG + Intronic
972421920 4:38895565-38895587 CTTCCCTTTGGAGTGTGAGCCGG - Intronic
975271111 4:72434595-72434617 CCCTCCCTTTGAGTGTGGGCAGG + Intronic
977317331 4:95466872-95466894 CATTCCCATTGGGTGTGGCCTGG + Intronic
978311443 4:107388364-107388386 TTTCCCCATTGGCTGTGGCCGGG - Intergenic
980698459 4:136391831-136391853 CATCGCCTTTGTGTGTGTGCAGG + Intergenic
981162649 4:141517189-141517211 CTTCTCCCTTGGTTGTTGGCCGG - Intergenic
983058650 4:163129343-163129365 CTTCACCTTTGAGTGAGGGGAGG + Exonic
984732779 4:183083925-183083947 CTTCCCTCTTGGTTGTGGGCTGG - Intergenic
984853492 4:184173634-184173656 CTTTCCATTTAGGTGTTGGCAGG + Intronic
985194577 4:187414851-187414873 CTTCCCCTTTGAATCTAGGCTGG - Intergenic
985786120 5:1895967-1895989 GTTCCCCTTGTGGTGTGGCCAGG + Intergenic
987780103 5:22423089-22423111 CTTCCCTTTTGTGTGTGTGTTGG + Intronic
988724394 5:33911490-33911512 CCTCCTCTTTGAGTGTGGACTGG + Intergenic
992616345 5:78549364-78549386 CCTGCCCCTTGGGTCTGGGCTGG - Intronic
994441318 5:99808208-99808230 CTTTCCCATTGAGTGTGGTCTGG - Intergenic
995092062 5:108189583-108189605 CTGCCCCCTTGAGTGTGGACAGG + Intronic
995429815 5:112061453-112061475 CTTCCCCTTTGGGGGCGGTAAGG + Intergenic
996051529 5:118940027-118940049 CCTCCCACTTGAGTGTGGGCTGG + Intronic
998006628 5:138661533-138661555 CCTCCCCTGTGACTGTGGGCAGG - Intronic
998185859 5:139979501-139979523 CTTCTCCCTTGAGTGTGGGTTGG + Intronic
999475980 5:151899410-151899432 CTGCCCCATTGCCTGTGGGCTGG + Intronic
999938512 5:156515563-156515585 CTGCTCCTTTGGCTGGGGGCGGG - Intronic
1001741997 5:174060952-174060974 CCTCCCTTTAGGATGTGGGCTGG - Intronic
1001840581 5:174873076-174873098 CTTCGCTGGTGGGTGTGGGCTGG + Intergenic
1002684461 5:180997298-180997320 CTTTCCACTTGGCTGTGGGCTGG - Exonic
1002763615 6:220061-220083 GTTCCCCATTCTGTGTGGGCAGG - Intergenic
1006983547 6:38163513-38163535 CTGGTCCTTTGGGAGTGGGCAGG - Intergenic
1007832135 6:44646779-44646801 CTCAACCTTTGGGTTTGGGCAGG - Intergenic
1007937731 6:45748274-45748296 CTCTCCCTTTGGGAGTGGGATGG - Intergenic
1010174146 6:73007073-73007095 CTTCCTTTTTGGATGTGGGATGG - Intronic
1010791500 6:80070267-80070289 CTTCCCCTTTGGGTGTGTGGTGG - Intergenic
1011037754 6:82996522-82996544 CTACCCCTTTGAGTGTGGGCTGG + Intronic
1012853597 6:104475330-104475352 CCTTCCCATTGAGTGTGGGCTGG - Intergenic
1012902500 6:105022559-105022581 CCTGCCTTTTGGGTATGGGCAGG + Intronic
1013240600 6:108241705-108241727 CCTCCCCTTTGGGGAGGGGCAGG + Intronic
1018309469 6:162493020-162493042 CTCCTCCCTTGGGTGTGGGAGGG - Intronic
1018607549 6:165613972-165613994 CTCCAGTTTTGGGTGTGGGCAGG - Intronic
1020682930 7:11259048-11259070 CTACCCCTTGGAGTGTTGGCTGG + Intergenic
1020841653 7:13225293-13225315 CCTCCCCCTTAAGTGTGGGCTGG + Intergenic
1023850825 7:44149359-44149381 CCTTCACTTTGGGTGGGGGCAGG + Intronic
1024587130 7:50851600-50851622 CTTCCCTTTTGGGCGGGGGGTGG + Intergenic
1026735894 7:72948534-72948556 CTTTCTCTTTGGGGCTGGGCTGG + Exonic
1026786241 7:73303466-73303488 CTTTCTCTTTGGGGCTGGGCTGG + Exonic
1027107839 7:75416527-75416549 CTTTCTCTTTGGGGCTGGGCTGG - Intergenic
1027592485 7:80134546-80134568 CTGCCCCTTCGGGTGGGGGTGGG - Intronic
1028451952 7:90995066-90995088 CTTTCCCCTTGAGCGTGGGCTGG + Intronic
1030005693 7:105117511-105117533 TTTCCCCTTTGTGTTTTGGCAGG - Exonic
1030836372 7:114292165-114292187 CCTTCCCCTTGAGTGTGGGCAGG - Intronic
1031187786 7:118504769-118504791 CCTCCCCTTTGGGTTTAGACTGG - Intergenic
1031337384 7:120552675-120552697 CTTCCCCTCTGAGTGTAGGGAGG + Intronic
1034694797 7:153043850-153043872 CTTCCCTTTTGGTTTTGGGTTGG - Intergenic
1034947388 7:155271816-155271838 CCCCCATTTTGGGTGTGGGCAGG + Intergenic
1035070300 7:156139813-156139835 CTTTCCCCTTGGGTCTGGGAAGG + Intergenic
1035699295 8:1626254-1626276 CTCACCCTCTGGGTGTGGGTTGG + Intronic
1035699335 8:1626422-1626444 CTCACCCTCTGGGTGTGGGTTGG + Intronic
1037143081 8:15540589-15540611 CTTCCCCTGTGGGCGGGGGCGGG + Intronic
1038046719 8:23771884-23771906 CTTCCACTTAGGGTCTGGCCTGG + Intergenic
1041890764 8:62865612-62865634 TTTCCCCTTTGTGTTTTGGCAGG + Intronic
1043453999 8:80395762-80395784 CTCTCCCCTTGAGTGTGGGCTGG - Intergenic
1043495191 8:80792475-80792497 CCTTCCCCTTGAGTGTGGGCTGG + Intronic
1045100724 8:98841215-98841237 CTCTCTCTTTGAGTGTGGGCTGG - Intronic
1045434997 8:102153527-102153549 CTTTCCCTTTGAGTATGGGCTGG - Intergenic
1047793192 8:128226503-128226525 CTCTCCCTTTGAGTGTGGGCTGG + Intergenic
1048923745 8:139252553-139252575 TTTTCCCTTTGGGGCTGGGCTGG + Intergenic
1049272039 8:141701083-141701105 CCTCCCCTCTGGGCCTGGGCGGG - Intergenic
1051360004 9:16273791-16273813 CTTCCCCCTTGAATGTGGGCAGG + Intronic
1051915905 9:22207448-22207470 CTGCTCCCTTTGGTGTGGGCAGG + Intergenic
1051934033 9:22422594-22422616 CTTTCACTTTTGGTGGGGGCAGG - Intergenic
1053785185 9:41648101-41648123 GTTCCGCTTTGGGTGTGTGAAGG - Intergenic
1054173912 9:61862048-61862070 TTTCCGCTTTGGGTGTGTGAAGG - Intergenic
1054448768 9:65391117-65391139 GTTCCGCTTTGGGTGTGTGAAGG - Intergenic
1054663628 9:67718733-67718755 GTTCCGCTTTGGGTGTGTGAAGG + Intergenic
1055553798 9:77455461-77455483 CTTCCCCTTTGGGTGTGGGCAGG - Intronic
1055617952 9:78092822-78092844 CTGTCCCCTTGAGTGTGGGCTGG + Intergenic
1055779385 9:79803090-79803112 CCCTCCCCTTGGGTGTGGGCTGG - Intergenic
1055818935 9:80238775-80238797 CATCCCCTGTTGGTGTGGGGAGG - Intergenic
1056297495 9:85207349-85207371 CTAACCCTTTGGGGGTGGGAAGG + Intergenic
1056719958 9:89063107-89063129 CTTCCCCCTTGAGTCTGAGCTGG + Intronic
1057614632 9:96578339-96578361 AGTCCCCTTTGAGTGTGGACTGG + Intronic
1058870719 9:109199317-109199339 CTCTCCCCTTGAGTGTGGGCTGG + Intronic
1060036657 9:120261662-120261684 CTTGCCCTCTGGGGGTGGACGGG + Intergenic
1060228206 9:121808960-121808982 CTGGCCCTTTGGCTCTGGGCAGG + Intergenic
1060627464 9:125126708-125126730 CTCCTCCCTTGAGTGTGGGCTGG - Intronic
1061021344 9:128017170-128017192 CTCACCCCTTGAGTGTGGGCTGG + Intergenic
1185642269 X:1594995-1595017 TGTGCCCTGTGGGTGTGGGCAGG + Intronic
1186099166 X:6136733-6136755 CTTCCCCCTTGAGTGTAGGCAGG - Intronic
1186288852 X:8074587-8074609 CTCTCCCCTTGAGTGTGGGCAGG - Intergenic
1186388332 X:9132752-9132774 TTTCCCCTCTGGGTGTGCTCTGG - Intronic
1186641427 X:11460027-11460049 CTTCCCATGTGAGTGTAGGCAGG + Intronic
1187013312 X:15301954-15301976 CCTGCCCCTTGAGTGTGGGCTGG + Intronic
1189127916 X:38467614-38467636 CTCTCCCCTTGGGTGTGAGCTGG + Intronic
1190871033 X:54424809-54424831 CTTGAGCTTCGGGTGTGGGCGGG - Intergenic
1190934071 X:54978590-54978612 CCTTCCCCTTGAGTGTGGGCTGG + Intronic
1190967406 X:55313667-55313689 CTCTCCCCTTGGGTGTGGGCAGG + Intergenic
1192399374 X:70818782-70818804 CTTCACCTGTGGGTGTGTGCAGG - Intronic
1192451005 X:71244843-71244865 CTTCCTCTTTGATTGTGGCCTGG - Exonic
1192888023 X:75357815-75357837 CCTCCCCTGTGGTTGTGGGCTGG + Intergenic
1193297123 X:79846419-79846441 CTCCCCCTTTGAATCTGGGCTGG + Intergenic
1193907473 X:87260844-87260866 CTGCCCTTATGGGTGTGGGAAGG - Intergenic
1194410531 X:93552438-93552460 GCACCCCTTTGGTTGTGGGCTGG + Intergenic
1195373421 X:104202231-104202253 TCTCCCCTTTGAGTGTGGGCTGG - Intergenic
1195386801 X:104321233-104321255 CTCTCCCCTTGTGTGTGGGCTGG + Intergenic
1195392231 X:104374814-104374836 CTTTTTCTTTGGGTGTGTGCTGG - Intergenic
1198960327 X:142175600-142175622 CTTCCACTTTGGGAGTCAGCCGG - Intergenic
1199828914 X:151529353-151529375 CTTCCCCCTTAAGTGTGGGCTGG - Intergenic
1199895874 X:152127569-152127591 CTTGCCCCTTTGGTGTTGGCAGG - Intergenic
1201147472 Y:11072923-11072945 CCTCCCCTGGGAGTGTGGGCTGG - Intergenic
1201500933 Y:14641882-14641904 CCTCCCCTTTGAGTGTAGGGAGG + Intronic