ID: 1055553800

View in Genome Browser
Species Human (GRCh38)
Location 9:77455466-77455488
Sequence AATCTCTTCCCCTTTGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055553800_1055553804 -2 Left 1055553800 9:77455466-77455488 CCACACCCAAAGGGGAAGAGATT 0: 1
1: 0
2: 2
3: 21
4: 167
Right 1055553804 9:77455487-77455509 TTATGCAGGACGTGTACACCAGG No data
1055553800_1055553806 0 Left 1055553800 9:77455466-77455488 CCACACCCAAAGGGGAAGAGATT 0: 1
1: 0
2: 2
3: 21
4: 167
Right 1055553806 9:77455489-77455511 ATGCAGGACGTGTACACCAGGGG No data
1055553800_1055553807 1 Left 1055553800 9:77455466-77455488 CCACACCCAAAGGGGAAGAGATT 0: 1
1: 0
2: 2
3: 21
4: 167
Right 1055553807 9:77455490-77455512 TGCAGGACGTGTACACCAGGGGG No data
1055553800_1055553805 -1 Left 1055553800 9:77455466-77455488 CCACACCCAAAGGGGAAGAGATT 0: 1
1: 0
2: 2
3: 21
4: 167
Right 1055553805 9:77455488-77455510 TATGCAGGACGTGTACACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055553800 Original CRISPR AATCTCTTCCCCTTTGGGTG TGG (reversed) Intronic
902989634 1:20177548-20177570 AATCTCATTCCCTTTGAATGTGG + Intergenic
906556620 1:46719106-46719128 GATCACTTCCCCTTTGGCAGCGG + Intergenic
907084309 1:51655606-51655628 AATCTCCTCCCCTTTGAGTATGG - Intronic
908199535 1:61780058-61780080 AATCTCATCCCCATTGTTTGAGG - Intronic
910803738 1:91170432-91170454 AATCTCTTCCTTTGCGGGTGAGG + Intergenic
911358298 1:96847594-96847616 ATGCTCTTCCCCTTTGTGTTTGG - Intergenic
912014528 1:105016536-105016558 AATCTCTCCAAGTTTGGGTGTGG + Intergenic
915193646 1:154172847-154172869 TATCCCTTCCCCTTTGGCTTGGG - Intronic
915914842 1:159934675-159934697 AATGTCTTCCACATTAGGTGGGG - Exonic
916634202 1:166650721-166650743 AATCTCTTCTCCATTGTGTGTGG - Intergenic
917776790 1:178345966-178345988 AATCTATTTCCCTTTGTTTGAGG - Intronic
918111910 1:181462367-181462389 AATCTCATTCACTGTGGGTGAGG - Intronic
918166097 1:181949069-181949091 AAGCTCTGCCCCTTTGGCTTTGG - Intergenic
920671414 1:208006339-208006361 AATCTCTTCCCCTTTGGTGTGGG + Intergenic
921100574 1:211925073-211925095 AAGCTCTTTCCGGTTGGGTGCGG - Intergenic
921696356 1:218215083-218215105 ATTCTCTTTGCCTTGGGGTGGGG + Intergenic
922254897 1:223885299-223885321 AATCTCTTCCCGTTTGAGTACGG + Intergenic
924779270 1:247131697-247131719 AATCCCTTCTTCATTGGGTGGGG + Intronic
1063647236 10:7897220-7897242 GATCCCGTCCTCTTTGGGTGTGG - Intronic
1068032352 10:51719225-51719247 AATTCCTTGCCCTTTGAGTGTGG + Intronic
1068384450 10:56307221-56307243 CATATCTTTGCCTTTGGGTGTGG - Intergenic
1075130006 10:119729489-119729511 AATCTCTGTCCATTTGGATGAGG + Intronic
1077773039 11:5242040-5242062 AATCTCATCTCCTTTAGATGGGG - Intergenic
1079924463 11:26476625-26476647 TCACTCTGCCCCTTTGGGTGGGG + Intronic
1080116880 11:28631328-28631350 AATCCCCTCCCCTTTGGGTGTGG - Intergenic
1080261650 11:30355638-30355660 AAACTCTTCTCTTTTGGTTGTGG - Intergenic
1082193039 11:49270179-49270201 ATTCTCCTTCCCATTGGGTGTGG + Intergenic
1083079490 11:60075384-60075406 AACCTCTACCTCTTTCGGTGAGG + Intergenic
1083293090 11:61700565-61700587 AATCTGTTCCCCTTGGCCTGAGG - Intronic
1085707310 11:78798373-78798395 ATTCTCTTTCCCTTTGGGTAGGG + Intronic
1091084671 11:132709724-132709746 AATCTCCCTCCCTTTGAGTGCGG - Intronic
1091979808 12:4855802-4855824 ATTCTCTTCCCCTTTGACAGAGG + Intergenic
1092981340 12:13797445-13797467 AATCTGTTCCCATTTGGGCAGGG + Intronic
1096065254 12:48734581-48734603 AATCACCTCCCTTTTGAGTGTGG + Intergenic
1097587570 12:61532559-61532581 AACCACTTCCCCTCTGGGTACGG + Intergenic
1097756790 12:63415916-63415938 AATTTCTTGCCTTTGGGGTGAGG - Intergenic
1105817643 13:24051507-24051529 AATCTCCTCCCCTAAGGGTTGGG - Intronic
1107104403 13:36627577-36627599 AATCTCTGATCCATTGGGTGTGG - Intergenic
1108743986 13:53370886-53370908 TATCTCTTCTCCTTGGGGTGGGG - Intergenic
1110128714 13:71979740-71979762 CAGCTCTTCCCATTAGGGTGGGG + Intergenic
1112503813 13:99961428-99961450 GATCTCTTCCACTTTGGGGAAGG - Intergenic
1113661166 13:112107348-112107370 ACTCTCCTCACCTTGGGGTGGGG - Intergenic
1113897461 13:113775426-113775448 GGTCTCCGCCCCTTTGGGTGGGG + Intronic
1118923484 14:70170886-70170908 AACCTCTTCTCCTCTGAGTGAGG - Intronic
1119890527 14:78178995-78179017 GGTGTCTTCCCCTGTGGGTGTGG - Intergenic
1121288515 14:92755617-92755639 AATCTCCTCCCCTTTGAGAATGG + Intergenic
1121322376 14:92999511-92999533 AATCTCTCCTCCAGTGGGTGGGG + Intronic
1123064675 14:105611496-105611518 AATCTCTACCCCTGTGGCTTTGG - Intergenic
1124179480 15:27458939-27458961 ATTCTCTTCCTCTCTGGCTGTGG + Intronic
1125360916 15:38863949-38863971 AATCTATTCAGCTTTGGGTCAGG + Intergenic
1125761335 15:42097547-42097569 ACTCTCTTCCCCCTTGGTTTGGG + Intergenic
1128080168 15:64852411-64852433 CATCTCTTCCCCTTTCTCTGAGG + Intronic
1129919252 15:79305834-79305856 ATTCTCTTCCCCTGTTGCTGTGG + Intergenic
1130709747 15:86268184-86268206 AAGTTCTTCCTCTTTGGGGGAGG + Intronic
1130870734 15:87969913-87969935 GATGGCTGCCCCTTTGGGTGAGG - Intronic
1131718623 15:95142332-95142354 AATCTCTTCTCTTTTTGTTGGGG + Intergenic
1132221595 15:100109279-100109301 ACTGTCTTCCCCTGTGGCTGTGG - Intronic
1133318106 16:4896472-4896494 AATCTCTGCCCTTTTGTGTCTGG - Intronic
1135991742 16:27222719-27222741 AATGTCCTGCCCTGTGGGTGAGG + Intergenic
1136506501 16:30707504-30707526 ATTTTCTTTGCCTTTGGGTGGGG + Intronic
1138333653 16:56234877-56234899 AATCTGTTTCACTTTGGGGGTGG + Intronic
1138782704 16:59808293-59808315 AAAATTTTCCCCTGTGGGTGTGG - Intergenic
1143650963 17:8264173-8264195 AGTCTCATCCCCTCTGGGTGGGG + Intronic
1143900534 17:10171156-10171178 AATCTTTTCCTCTTTTGGTTTGG + Intronic
1145972932 17:28967587-28967609 AACCTCCTCCACTCTGGGTGTGG - Intronic
1148696824 17:49565533-49565555 ATTCTTTTCCCTTGTGGGTGAGG - Intergenic
1149382886 17:56111198-56111220 AATCTCTTCCCCACTGGCTTGGG + Intronic
1150327312 17:64267558-64267580 AATCTCTTCTCCCTTGGGTTTGG - Intergenic
1151361783 17:73593408-73593430 CATCTCTGTTCCTTTGGGTGGGG - Intronic
1156148279 18:34213037-34213059 AATCCCTTCTCCTTTGAGTGTGG - Intronic
1157113324 18:44841461-44841483 AATCCCTTTCCCCTTGAGTGTGG - Intronic
1157519349 18:48334717-48334739 AATAACTTCCCCTTAGGGTAGGG - Intronic
1157943570 18:51955118-51955140 CATCTCTTTCCTTTTGGGTCTGG - Intergenic
1159256670 18:65955792-65955814 AATCACTTCCCCTTAGTGCGTGG - Intergenic
1161647972 19:5466086-5466108 AATCCCTTGTCCTTGGGGTGGGG - Intergenic
1163190466 19:15673310-15673332 CATCTCTTTCCCTTTCTGTGTGG + Intronic
1165672362 19:37690178-37690200 AATCTCTTCTCAGCTGGGTGCGG + Intronic
924999793 2:395926-395948 AATCTCCTCCGCTGAGGGTGAGG - Intergenic
925417637 2:3682329-3682351 AATGTCTTCACCTTGAGGTGTGG - Intronic
926194185 2:10752148-10752170 AATGTGTTCCCTCTTGGGTGGGG + Intronic
927427402 2:22996244-22996266 AATCACTTCCCCTCTGGGCAGGG + Intergenic
927740578 2:25565959-25565981 GATCTCTTCCCCTTTGAGTGTGG + Intronic
928325396 2:30315556-30315578 TATTTCTCCCCCTTTGGCTGAGG - Intronic
929244451 2:39686549-39686571 AATGTTTTCCCCTTGGGTTGAGG + Intronic
932168019 2:69526062-69526084 CAACTCTTCTCCTTTGGGAGAGG - Intronic
932625779 2:73294674-73294696 CATCTCATACCCTGTGGGTGAGG - Intergenic
934540516 2:95170286-95170308 AATCTCTCCCCGTTAGGTTGGGG + Intronic
940628495 2:156207840-156207862 AATTTCTTGGCCTTTGGATGAGG - Intergenic
941011756 2:160308118-160308140 AATCATTTCCCCACTGGGTGTGG + Intronic
941551196 2:166917569-166917591 CATCTCTTCCCATTTGTTTGTGG + Intronic
941657368 2:168158485-168158507 AATCGATTCCCCTTTGGGCCAGG - Intronic
941862924 2:170303342-170303364 AATCTCTGCCTCCTTGGCTGTGG + Intronic
947550313 2:231040759-231040781 AGTCTCTTTACCTTTGGGTGCGG + Intronic
948012651 2:234662187-234662209 AACCTCTTCCCCACTGGTTGAGG - Intergenic
948351164 2:237342289-237342311 AATATCTTCTCATTTGGGGGTGG + Intronic
1175983315 20:62752297-62752319 AATCTCTCCCGCTCTGGGTAAGG - Intronic
1177672026 21:24244746-24244768 AATCTCTTGACCTCTGGATGGGG + Intergenic
1178305957 21:31490332-31490354 AATCTCTGCATTTTTGGGTGTGG - Intronic
1182912277 22:33994883-33994905 AATCTCCTCCCCTTGGAGTATGG - Intergenic
1182917166 22:34044963-34044985 TCTCTCTTTCACTTTGGGTGGGG + Intergenic
1183763499 22:39847694-39847716 AAGTTTTTCCCCGTTGGGTGTGG - Intronic
1184993091 22:48183664-48183686 AATCACCTCCCCTGTGGGTGAGG - Intergenic
949622125 3:5825214-5825236 AATCCCTTCCCTTTTGGTGGTGG + Intergenic
951697102 3:25456410-25456432 AATCTCTTGCCTTTTTGGTAAGG - Intronic
951800625 3:26591862-26591884 AATCTTTTCCCCTTTAAGTATGG + Intergenic
953665691 3:44924676-44924698 AATCTCTTCCCCCTAGGGGAGGG + Intronic
954198123 3:49008047-49008069 AGTCTCTTCCCCCTAAGGTGGGG + Intronic
955534135 3:59905073-59905095 ACTCTCTTCCACTTGAGGTGGGG + Intronic
956367759 3:68523197-68523219 AGTGTTTTCTCCTTTGGGTGGGG - Intronic
957547287 3:81656104-81656126 AATCTCTTTGCCATTGTGTGAGG + Intronic
959717816 3:109452720-109452742 AATTTCATCCCAGTTGGGTGGGG + Intergenic
961429615 3:126872038-126872060 TATGTCTTCCCCTTAGGGTGTGG + Intronic
962594030 3:136921708-136921730 AGTCTCTTCCCCTTTTGTTTTGG - Intronic
963273915 3:143311931-143311953 AATCTTTTCCCCATTGGATAGGG - Intronic
964790135 3:160446211-160446233 AATCTCCTCTCCCTTGAGTGTGG + Intronic
967337371 3:188359648-188359670 AATCTCTTCCTCTATACGTGAGG + Intronic
969439032 4:7206525-7206547 AATCTCCACCCCGTGGGGTGGGG + Intronic
972023020 4:34338826-34338848 AATCGCTTGACCTTTGGGGGTGG - Intergenic
972095189 4:35340133-35340155 AGTCTCTTCACCTTTGTCTGAGG + Intergenic
972285249 4:37642084-37642106 AACCTCTGTCCCTTTGGGCGGGG - Intronic
972453180 4:39224968-39224990 AATCTGGTCCCATTTGGGTCGGG - Exonic
973180875 4:47265443-47265465 AATTTATTTTCCTTTGGGTGTGG + Intronic
973713523 4:53652468-53652490 AATCTCTTCTGGTTTGGATGGGG + Intronic
974356788 4:60823077-60823099 AATCTCTCTCCCTATGGCTGAGG - Intergenic
974876072 4:67704081-67704103 TATCTCTTCCTCTGTTGGTGAGG - Intergenic
976403666 4:84637074-84637096 AAACTCTTCCCCTCTTGGGGAGG + Intronic
976427576 4:84923601-84923623 AATCTCTTCCCCTGTAGGAGAGG - Intronic
978811623 4:112855825-112855847 AATGTCCTCCCCTTTGGATTTGG + Intronic
983058647 4:163129338-163129360 AAAATCTTCACCTTTGAGTGAGG + Exonic
983811521 4:172067947-172067969 AATCAGTTCCTCTTGGGGTGGGG + Intronic
984065825 4:175046697-175046719 ATAATCTTCCCCTTTGGTTGTGG - Intergenic
984520322 4:180794837-180794859 AATCTCTTGCCCTACAGGTGAGG - Intergenic
984732783 4:183083930-183083952 AATCCCTTCCCTCTTGGTTGTGG - Intergenic
985327999 4:188794807-188794829 AATTCCTTCCCCATTTGGTGTGG + Intergenic
985474512 5:72026-72048 AATCTTTTCCGCAGTGGGTGGGG + Intergenic
985818536 5:2144621-2144643 AATCTCTTCTCCTTTTTGAGTGG + Intergenic
994153386 5:96475035-96475057 GTTCTCTTGCCCTTTGGTTGGGG + Intergenic
994212882 5:97105846-97105868 ATTCCCTTTCCATTTGGGTGTGG + Intronic
995092059 5:108189578-108189600 AATCCCTGCCCCCTTGAGTGTGG + Intronic
1000483622 5:161810833-161810855 AATCTATTTCTCTTGGGGTGGGG + Intergenic
1001330912 5:170761753-170761775 TATCTCATACCCTCTGGGTGTGG - Intergenic
1003348595 6:5294608-5294630 GATGACTTCCTCTTTGGGTGTGG + Intronic
1005631369 6:27711257-27711279 AATGTCTTGGCCTTGGGGTGAGG + Intergenic
1007375012 6:41450699-41450721 GCTCTATTCCCCTTTGGTTGCGG - Intergenic
1007430764 6:41775442-41775464 AACCTCTTCTCCTTTGAGAGTGG - Exonic
1007489605 6:42208825-42208847 AATTTCTGCCTCTTTCGGTGGGG - Intronic
1008096354 6:47343377-47343399 AATCTCTCTCCCTTTATGTGGGG - Intergenic
1009712258 6:67339609-67339631 AATCTCAATCCCTTTCGGTGTGG + Intergenic
1010002985 6:70967081-70967103 AATCTCTGCCCATATTGGTGAGG - Intergenic
1010284199 6:74055986-74056008 AATCTTTTCCCCTTTGTGTTTGG + Intergenic
1010339314 6:74729720-74729742 AATTTTTTCTCCTTTGGATGGGG + Intergenic
1013027112 6:106286563-106286585 AATCCCTTCCCCCTTGCATGTGG + Intronic
1014239274 6:118997012-118997034 GATCTCTTCCTGTTTGGGTCTGG - Intronic
1015922986 6:138283969-138283991 AGTCTCATCCTCTTGGGGTGAGG + Intronic
1023268357 7:38432940-38432962 AATGGCTTCCACTATGGGTGAGG + Intronic
1029291441 7:99504958-99504980 AAGCTCCTCCCCTTTCCGTGGGG - Exonic
1031616459 7:123887732-123887754 AGCCTCTTCACCTTTGTGTGTGG + Intergenic
1033098255 7:138449328-138449350 AATTTCTTGCCTTTTGGGTGAGG + Intergenic
1033098260 7:138449370-138449392 AATATCTTGCCTTTTGGGTGAGG + Intergenic
1034630746 7:152528797-152528819 TATCTCTGCCGCTTTGAGTGGGG + Intergenic
1036195077 8:6707430-6707452 TTTCTCCTCCCCTTTGGCTGTGG - Intergenic
1038697959 8:29822903-29822925 AATATTTTCCCCTTTGTGTCTGG - Intergenic
1046082003 8:109380596-109380618 AATCTGGTCCCCATTGGTTGAGG - Intronic
1046673308 8:117081427-117081449 CATCTCTTCCTCTTTTTGTGAGG + Intronic
1047380071 8:124353169-124353191 AATCCCTTCCCCTTAGTGTGTGG - Intronic
1048800950 8:138193429-138193451 ACTCTCTTTCCTTCTGGGTGTGG - Intronic
1050036564 9:1442352-1442374 AATTCCTTTCCCTTTGAGTGTGG - Intergenic
1050152629 9:2632109-2632131 TATCTCTGCTCCTTTGGGTGAGG - Intronic
1051360000 9:16273786-16273808 AATCCCTTCCCCCTTGAATGTGG + Intronic
1051483958 9:17588309-17588331 ACTCTCCTCCCCTTTGAGTGTGG + Intronic
1053105659 9:35405837-35405859 TATTTCTTCCCCTTTGGGAGTGG - Intergenic
1055414690 9:76068738-76068760 ATTTTCTTCCCATTTGTGTGTGG - Intronic
1055553800 9:77455466-77455488 AATCTCTTCCCCTTTGGGTGTGG - Intronic
1057696034 9:97323628-97323650 ATTCTGTTCCCCTTAGGGTCTGG - Intronic
1059779539 9:117511951-117511973 AATCTTTTCCCTTTTTGCTGCGG + Intergenic
1061767352 9:132889745-132889767 AGTTTATTCCCCTTTGGCTGTGG - Intronic
1062100538 9:134726077-134726099 ACTCTCTTCCCCAGTGGTTGAGG + Intronic
1186728297 X:12381036-12381058 AATATGTTCCTCTTTGGCTGAGG - Intronic
1189285696 X:39850796-39850818 AATCTCTCCCCCTTAGTGTGGGG + Intergenic
1189963873 X:46351894-46351916 AATCTCTTTCCAGCTGGGTGTGG - Intergenic
1191117193 X:56864609-56864631 AATGTCTTCCCCTTTTTGTAAGG - Intergenic
1192741976 X:73902334-73902356 CATCTTTTCCCCTTTCAGTGTGG + Intergenic
1195001249 X:100645350-100645372 ACTCTCGTCCCATTAGGGTGAGG + Intronic
1195046359 X:101058072-101058094 CTCCTCTTCCCCTTTGGTTGGGG + Intergenic
1195807200 X:108787756-108787778 ACTCTCTTCCACTGTTGGTGGGG - Intergenic
1196019882 X:110980279-110980301 AATCCCCTCCCCTCTGAGTGTGG - Intronic
1196125051 X:112088304-112088326 AATGTCTACCCTTTTGGGTCTGG + Intergenic
1197114356 X:122815320-122815342 AATCTTTTACCTTTTGGGGGGGG + Intergenic
1197795684 X:130295808-130295830 AATCTCTGCGCCACTGGGTGAGG - Intergenic
1198786832 X:140297984-140298006 ATTATTTTCCCCTTTGAGTGGGG + Intergenic
1201565922 Y:15365315-15365337 AGTCACTTCCCCTCTGGGAGGGG - Intergenic