ID: 1055553801

View in Genome Browser
Species Human (GRCh38)
Location 9:77455471-77455493
Sequence TGCATAATCTCTTCCCCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 232}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055553801_1055553809 27 Left 1055553801 9:77455471-77455493 CCCAAAGGGGAAGAGATTATGCA 0: 1
1: 0
2: 1
3: 22
4: 232
Right 1055553809 9:77455521-77455543 TCAGAATTCTGCCCAGCACATGG No data
1055553801_1055553806 -5 Left 1055553801 9:77455471-77455493 CCCAAAGGGGAAGAGATTATGCA 0: 1
1: 0
2: 1
3: 22
4: 232
Right 1055553806 9:77455489-77455511 ATGCAGGACGTGTACACCAGGGG No data
1055553801_1055553807 -4 Left 1055553801 9:77455471-77455493 CCCAAAGGGGAAGAGATTATGCA 0: 1
1: 0
2: 1
3: 22
4: 232
Right 1055553807 9:77455490-77455512 TGCAGGACGTGTACACCAGGGGG No data
1055553801_1055553805 -6 Left 1055553801 9:77455471-77455493 CCCAAAGGGGAAGAGATTATGCA 0: 1
1: 0
2: 1
3: 22
4: 232
Right 1055553805 9:77455488-77455510 TATGCAGGACGTGTACACCAGGG No data
1055553801_1055553804 -7 Left 1055553801 9:77455471-77455493 CCCAAAGGGGAAGAGATTATGCA 0: 1
1: 0
2: 1
3: 22
4: 232
Right 1055553804 9:77455487-77455509 TTATGCAGGACGTGTACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055553801 Original CRISPR TGCATAATCTCTTCCCCTTT GGG (reversed) Intronic
900922411 1:5681762-5681784 GGTATAATCCCTTCCCCTTGAGG - Intergenic
905366911 1:37457244-37457266 TCCATCATCTCATCCGCTTTAGG + Intergenic
906031172 1:42721246-42721268 TTCATTATCTTTTCCCCTCTTGG + Intergenic
907713999 1:56910915-56910937 TGGCAAATCACTTCCCCTTTGGG + Intronic
907940035 1:59078619-59078641 TGCATTTTCTGTTCCCCATTAGG - Intergenic
909340517 1:74526285-74526307 TACATATTCTTTTCCCCTTTTGG - Intronic
909787869 1:79639311-79639333 AGCTTAATCTCTTCCACTCTAGG - Intergenic
910598889 1:89009478-89009500 TGCAGAATCTCTTCAGCCTTAGG + Exonic
910603328 1:89055199-89055221 TGCAGAATCTCTTCAGCCTTAGG + Exonic
910637387 1:89423912-89423934 TGCAGAATCTCTTCAGCCTTAGG - Intergenic
911799838 1:102122176-102122198 TTCATATTCTCTTCACCTTCTGG - Intergenic
913029520 1:114885407-114885429 TGCATATTTTCTTCTCATTTTGG + Intronic
913538257 1:119794970-119794992 GGCAGAATTTCTTCCTCTTTGGG - Intronic
923392332 1:233525405-233525427 TACATAATTTCTTTTCCTTTGGG - Intergenic
923784244 1:237052301-237052323 TCCATCATCTCTTCACCTTTTGG - Intronic
924084874 1:240440715-240440737 TGCAAAATCTATTACCCTCTTGG + Intronic
924406374 1:243751753-243751775 TGCAAGCTCTCTTCCCCTGTGGG - Intronic
924648615 1:245903376-245903398 TTTATAATTTCTTCTCCTTTTGG - Intronic
1064604612 10:17026038-17026060 TGCAGCCTCCCTTCCCCTTTGGG + Intronic
1069248437 10:66238640-66238662 TGTATAATCTGATCCCATTTTGG + Intronic
1071945561 10:90640016-90640038 TTCAAAATGTTTTCCCCTTTAGG - Intergenic
1072572763 10:96673112-96673134 AGCAGAATCTTTTCCCCTTTTGG - Intronic
1072896758 10:99374054-99374076 TACATAATTTCTTTTCCTTTGGG + Intronic
1074620203 10:115111118-115111140 AGATCAATCTCTTCCCCTTTTGG - Intronic
1079447756 11:20572046-20572068 AGCTTAATCTCTCCCACTTTAGG + Intergenic
1081239698 11:40689724-40689746 TGCATAAACTTTTCCCTTTTAGG + Intronic
1081400622 11:42637947-42637969 TTCATAATCTCTGATCCTTTTGG + Intergenic
1081901453 11:46631916-46631938 TGCATGTTCTCTTACACTTTGGG + Intronic
1082559349 11:54600377-54600399 TGCATACTCTTTTCACCTTCTGG + Intergenic
1085710726 11:78826848-78826870 GGAATAATCTCTTCTCATTTAGG + Intronic
1087138972 11:94747255-94747277 TTCATAATTTGTTGCCCTTTGGG + Intronic
1087324129 11:96700253-96700275 AGTATAATCTCTTCCCTCTTGGG + Intergenic
1087731469 11:101782989-101783011 GGCATGATCTCATTCCCTTTTGG + Intronic
1087841850 11:102928562-102928584 TGCAATTGCTCTTCCCCTTTGGG - Intergenic
1089426853 11:118384573-118384595 AGCATAAACTCTTCCTCTTATGG + Intronic
1090787052 11:130058676-130058698 TGCCTGATCCCTGCCCCTTTAGG + Intergenic
1091611381 12:2013049-2013071 GGCATAATGTCTTTCTCTTTTGG + Intronic
1092088234 12:5783436-5783458 TTCATAATCTCTACCCCTAGGGG + Intronic
1094403818 12:30093175-30093197 TGCTCAAGCTCTTGCCCTTTGGG - Intergenic
1094424527 12:30304647-30304669 TTTGTACTCTCTTCCCCTTTGGG - Intergenic
1094476325 12:30843436-30843458 TTTGTATTCTCTTCCCCTTTCGG - Intergenic
1095773088 12:45984264-45984286 TGCAAAATGTCTTCCAATTTGGG + Intronic
1096539574 12:52297740-52297762 TGCATTATCTCTTCCATTTAGGG - Intronic
1098991655 12:77070339-77070361 TGAATAGTCTTTTACCCTTTTGG + Intergenic
1099291690 12:80783663-80783685 AGCTTAATCTCTTCCACTCTAGG - Intergenic
1099803163 12:87482391-87482413 AGCAGAATCTGTTCCCATTTTGG - Intergenic
1100370313 12:93963345-93963367 TGTATTATCTCTATCCCTTTTGG + Intergenic
1101388731 12:104280729-104280751 TGCAGAATTGCTTCCTCTTTGGG - Intronic
1102178730 12:110895505-110895527 TTCATCATCTCCTTCCCTTTGGG + Intronic
1102695006 12:114792040-114792062 TGAATAATCTCCTGCCCTCTTGG - Intergenic
1103240458 12:119409066-119409088 TGTATAATCTCCTCCCCTGGAGG - Intronic
1103319062 12:120080009-120080031 TCCGAAATCTCTTCCCATTTTGG - Intronic
1105817645 13:24051512-24051534 GGCATAATCTCCTCCCCTAAGGG - Intronic
1107271405 13:38621917-38621939 TGTATAATCTCTTGCTCATTGGG + Intergenic
1109590319 13:64471175-64471197 TGTATCATCAATTCCCCTTTCGG - Intergenic
1111157717 13:84350406-84350428 TGCATATTCTCTTCTCATTCTGG + Intergenic
1113145207 13:107200339-107200361 TTCATCATCACTTCCTCTTTGGG - Intronic
1117163185 14:53008817-53008839 TGTATAATCTCCTCTCCTTGAGG + Intergenic
1117457079 14:55908906-55908928 TGTATGATCTCTTTCTCTTTGGG - Intergenic
1117905354 14:60579422-60579444 TGTGTAATCTCCTCCCCTTAAGG - Intergenic
1117982917 14:61359489-61359511 TGCATAAGCACTTCCCTGTTGGG + Intronic
1119151161 14:72360666-72360688 TGCAAAATCTCTACCATTTTTGG - Intronic
1120749152 14:88181708-88181730 AGCTTAGTCTCTTGCCCTTTGGG - Intronic
1124396410 15:29305901-29305923 TGCTGAAGCACTTCCCCTTTAGG + Intronic
1126234882 15:46372305-46372327 AGAATAATTTCTTTCCCTTTGGG - Intergenic
1128717169 15:69917155-69917177 TGAATACTGTCTTACCCTTTTGG + Intergenic
1130264190 15:82384507-82384529 TGCCTAACCTCTTCCCATTTAGG + Intergenic
1130474450 15:84251753-84251775 TGCCTAACCTCTTCCCATTTAGG + Intergenic
1130481865 15:84365801-84365823 TGCCTAACCTCTTCCCATTTAGG + Intergenic
1130508174 15:84566258-84566280 TGCCTAACCTCTTCCCATTTAGG - Intergenic
1131051783 15:89353091-89353113 GGCAGAATCTCTTTCTCTTTGGG + Intergenic
1131211018 15:90496620-90496642 TGCATAATACCTTTTCCTTTTGG + Intronic
1132428474 15:101741268-101741290 TGCCTAACCTCTCCCCATTTAGG - Intronic
1134346359 16:13395384-13395406 TGCATAGACTCTTGCCCTATGGG - Intergenic
1135254964 16:20933791-20933813 TGCACAATCCCTTCCCTTTCTGG + Intronic
1136958217 16:34810509-34810531 TTCATATTCTATTCCCATTTTGG - Intergenic
1137942464 16:52702255-52702277 CGTATAATTTCTTTCCCTTTGGG + Intergenic
1138228176 16:55316885-55316907 TGCAAACTCTCTTTCTCTTTTGG + Intergenic
1138431410 16:56971537-56971559 TGGCAAATCTCTGCCCCTTTGGG + Intronic
1139337223 16:66241219-66241241 TGCATTATGTCTTCCATTTTTGG - Intergenic
1139461815 16:67128618-67128640 TGCCACATCTCTTCCCCTCTGGG + Intronic
1139821683 16:69726303-69726325 TCCCTAATCTCTTCCCTTTGTGG + Intronic
1139970898 16:70774298-70774320 TGCAGAATGTCTCCCCGTTTGGG + Intronic
1140538625 16:75734173-75734195 TTCATACTCTCATCCTCTTTGGG + Intronic
1140635541 16:76908634-76908656 TACATTATCTCTTCTCCTTGAGG - Intergenic
1141092320 16:81138685-81138707 TCCAGTATCTCTTCCCCTTAGGG + Intergenic
1142025455 16:87810527-87810549 AGCAGAATCACTTCCCCATTTGG - Intergenic
1143650960 17:8264168-8264190 TTCATAGTCTCATCCCCTCTGGG + Intronic
1146099957 17:29971860-29971882 TGAAAAATGTTTTCCCCTTTTGG + Intronic
1146202864 17:30875216-30875238 TACATCCTCTCTTCCCCTCTAGG - Intronic
1150472688 17:65450627-65450649 TGCATTTTCTCTTTCCCTCTGGG - Intergenic
1151104427 17:71595853-71595875 TTCACAATCTCAGCCCCTTTTGG + Intergenic
1153661931 18:7333197-7333219 TGCATAACCACTTCCCATGTGGG + Intergenic
1155605085 18:27596049-27596071 TGCTTCATCTCTTCCCCAGTGGG + Intergenic
1156330734 18:36119267-36119289 TACATGTTCTCTTCCCTTTTTGG - Intronic
1157697581 18:49735313-49735335 TGCATGTTCTCTTCACCTCTTGG - Intergenic
1157905988 18:51570618-51570640 AGCTTAATCTCTTCCACTCTAGG - Intergenic
1158343632 18:56492310-56492332 TGCTGACTCTCTTCCTCTTTTGG - Intergenic
1158949986 18:62485362-62485384 TGCATGATTTGTTCTCCTTTAGG - Intergenic
1159461649 18:68728532-68728554 TGCATTATCTCCTCAGCTTTAGG + Intronic
1159546960 18:69851585-69851607 TGAATAATATTTTCCCCCTTTGG - Intronic
1161650998 19:5484792-5484814 TGTATAATCTGATCCCCCTTGGG + Intergenic
1164153529 19:22574375-22574397 AGCTTAATCTCTCCCACTTTAGG + Intergenic
1164660616 19:29963214-29963236 TGCATTCTCTCTTCCCTTTCTGG + Intronic
1164673780 19:30088687-30088709 TGGACAATCTCTTCGTCTTTGGG + Intergenic
1167046210 19:47050424-47050446 AGCTTAATCTCTCCCACTTTAGG - Intergenic
926377862 2:12251867-12251889 AGAATTATCTCTTCCCATTTAGG - Intergenic
930342065 2:50129508-50129530 TGCTAATTCTCTTCCCTTTTTGG - Intronic
930435283 2:51333155-51333177 TGCAAAAACTCTTCCAATTTAGG - Intergenic
930958881 2:57234679-57234701 AGCTTAATCTCTTCCACTCTAGG + Intergenic
931783086 2:65596642-65596664 TCCATAATTTGGTCCCCTTTGGG + Intergenic
932482504 2:72054519-72054541 TGCATATCCTCTTCAACTTTTGG + Intergenic
932885144 2:75542629-75542651 TGCATAATCACTCCCTCTTTTGG + Intronic
933204966 2:79496560-79496582 TGCAGAATATCTTCCATTTTGGG + Intronic
933469416 2:82702275-82702297 GGCACAATCACTGCCCCTTTTGG - Intergenic
935374977 2:102386739-102386761 TGCATTATTTCTTCCCTTTCTGG - Intronic
936583033 2:113722543-113722565 TGAATAAACTCTTCCCTTCTAGG + Intronic
936804740 2:116316827-116316849 TGCATACTTTCTTCCACATTCGG - Intergenic
936811086 2:116403196-116403218 TGCATAATATCCTCTCCTTGAGG + Intergenic
937038575 2:118803026-118803048 TGTTTAGTGTCTTCCCCTTTTGG - Intergenic
940955317 2:159720359-159720381 TACATAATGTCTTCCATTTTGGG + Intronic
941548004 2:166878034-166878056 TAAATAATGTCTTCCCTTTTTGG + Intergenic
942558008 2:177191214-177191236 TGACCAATCTCTTCCCCTTCTGG - Intergenic
943774240 2:191747902-191747924 TGCATGATTTCTTACCTTTTGGG - Intergenic
944328947 2:198442283-198442305 TGCATATTATCTTCCCTTCTTGG + Intronic
945576550 2:211537210-211537232 TGCATAATATCTTTACCATTGGG - Intronic
1169880726 20:10343110-10343132 TGCATAATCTTTCCTCATTTGGG - Intergenic
1170828057 20:19813983-19814005 TGAATAATCTCTTCCGGTCTTGG + Intergenic
1171773578 20:29345996-29346018 TCCATAATCCCTTCTCCTTTGGG + Intergenic
1173887622 20:46474785-46474807 TGCATAATGTATTGCTCTTTGGG + Intergenic
1174266200 20:49333912-49333934 TACAATTTCTCTTCCCCTTTTGG - Intergenic
1174755633 20:53155622-53155644 TGCACAATATCTTCCCACTTTGG + Intronic
1176968818 21:15242491-15242513 TGCTTACTCTTCTCCCCTTTGGG + Intergenic
1177200716 21:17952627-17952649 CACATAATCTCTTCTCCTCTAGG - Intronic
1177468104 21:21516695-21516717 TGCTTAATCTCTTCTATTTTTGG + Intronic
1180580292 22:16829224-16829246 TGCATAATCTGGTACTCTTTTGG - Intergenic
1181185204 22:21098419-21098441 TGCATAATGCCCTCCCCTTGAGG - Intergenic
951302262 3:21012364-21012386 TGTATAATGTCTTTTCCTTTGGG + Intergenic
951361535 3:21730309-21730331 GGCATCGTCTTTTCCCCTTTGGG - Intronic
951772338 3:26272339-26272361 AGCCTAAGCTCTTACCCTTTTGG + Intergenic
953139685 3:40216072-40216094 AGCAGAATATCTTCCTCTTTAGG + Intronic
954766376 3:52920855-52920877 TGTATATTCTCTACCCATTTTGG - Intronic
955342210 3:58133672-58133694 TACATAAGCTCTTCACCTCTTGG + Intronic
956548552 3:70435229-70435251 AGCTTAATCTCTCCCCCTCTAGG - Intergenic
956646197 3:71459458-71459480 TCCATCATCTGTTCCCCTGTAGG - Intronic
957182199 3:76893175-76893197 ATCATCATCTCTTCCCCTTTGGG + Intronic
958455786 3:94328985-94329007 TGCCTAATCACTTCCTCTTTGGG - Intergenic
958894696 3:99816790-99816812 TACATAATATCTTCCCTTTTGGG + Intergenic
959371710 3:105534978-105535000 CAAATAATCTCTTCCTCTTTAGG + Intronic
960050122 3:113231590-113231612 TGCATACTCTCTCCCACTCTTGG + Intronic
961711230 3:128829795-128829817 AGCTTAATCTCTTCCACTCTAGG - Intergenic
961712260 3:128836657-128836679 AGCTTAATCTCTTCCACTCTAGG - Intergenic
962025849 3:131546768-131546790 TGGATGATCTCATCCCCTCTGGG - Intronic
963038869 3:141054120-141054142 TGCAGAATTCCTTGCCCTTTTGG + Intronic
963469008 3:145715525-145715547 AGCTTAATCTCTCCCACTTTAGG + Intergenic
964234673 3:154511478-154511500 TGCATACTATATTCCCCTGTTGG - Intergenic
964984049 3:162717694-162717716 AGCTTAATCTCTTCCACTCTAGG + Intergenic
970262970 4:14248580-14248602 TCCAAAATCTCTTAACCTTTAGG + Intergenic
970981256 4:22100124-22100146 TGAGTAATGTCTTGCCCTTTTGG - Intergenic
971836167 4:31766034-31766056 TGCATAATGTCTTTCAATTTTGG - Intergenic
973158952 4:46992900-46992922 TGCACAATTTCTCCTCCTTTTGG + Exonic
973579560 4:52329021-52329043 TGCAGTATCTCTCTCCCTTTAGG + Intergenic
976427577 4:84923606-84923628 TTAAGAATCTCTTCCCCTGTAGG - Intronic
976719080 4:88152875-88152897 AGCTTAATCTCTCCCACTTTAGG - Intronic
977924599 4:102685853-102685875 TACATAGTCTCTTCCACTGTAGG + Intronic
978154330 4:105473027-105473049 TGCATTATCGCTCCCCTTTTCGG - Intronic
978619433 4:110623384-110623406 AGCCTCATCTCTTCACCTTTGGG - Intronic
980373782 4:131915135-131915157 TGTAATATCTCTTTCCCTTTTGG + Intergenic
983055775 4:163097318-163097340 AGCTTAATCTCTCCCACTTTAGG + Intergenic
983789332 4:171776065-171776087 TGAATAATATTTTCACCTTTGGG - Intergenic
984213892 4:176883853-176883875 TGCATAAGCTCTGACTCTTTAGG + Intergenic
987205963 5:15625973-15625995 TTCAGAATCTCTTCCTCTTAAGG - Intronic
987282395 5:16424848-16424870 AGCATAATCTCTCCCACTCTAGG + Intergenic
989058996 5:37391588-37391610 TGCAGAATCTCCTTCCTTTTTGG + Intronic
990056447 5:51586444-51586466 TTGATAATCTCCTCTCCTTTGGG + Intergenic
991023329 5:62004080-62004102 TTAACAATCTCTTCCACTTTTGG + Intergenic
991415966 5:66393226-66393248 TGCATTTTCTCTTTCTCTTTTGG + Intergenic
991655469 5:68899871-68899893 AGCATAACCTCTTTCCCATTTGG + Intergenic
993752426 5:91687455-91687477 TGTTTAATCTCTTCTCCTTCAGG + Intergenic
994342118 5:98642647-98642669 TGTCTTATCTCTTCCCCTTCAGG + Intergenic
994515277 5:100764035-100764057 TACATAATCTATTTCCCTTTGGG - Intergenic
994889091 5:105606056-105606078 AGCATAATTTATTACCCTTTGGG - Intergenic
995223052 5:109672635-109672657 TGCATGATTTCCACCCCTTTTGG - Intergenic
995333695 5:110975392-110975414 TGCACAAACTCTTTCACTTTTGG - Intergenic
996033891 5:118736843-118736865 CTGATATTCTCTTCCCCTTTAGG - Intergenic
996574583 5:124967236-124967258 AGCTTAATCTCTCCCACTTTAGG - Intergenic
998591293 5:143481320-143481342 TACATAATCTCTACGTCTTTTGG + Intergenic
1000295490 5:159909752-159909774 GGCATAACCTCTTTCACTTTTGG - Intergenic
1001118165 5:168956889-168956911 TGCATATTCTCTTCACCTCAAGG + Intronic
1001930147 5:175667055-175667077 TGTATAATATATTCCCCTTTGGG - Intronic
1003241101 6:4346581-4346603 TGCATAAAATCCTCCACTTTTGG + Intergenic
1005560330 6:27033936-27033958 TTCCTTATCTCTTCCTCTTTTGG - Intergenic
1005563028 6:27060867-27060889 TTCCTTATCTCTTCCTCTTTTGG - Intergenic
1006526651 6:34611709-34611731 TGGATGATCTCTTCCACTTGTGG - Intronic
1007518125 6:42429588-42429610 TGGATAATCTCTTTGCCTGTAGG - Intronic
1008457644 6:51729098-51729120 ATAATAATCTCTTCCCTTTTGGG - Intronic
1009196563 6:60693679-60693701 TTCATAATGTCTTACCTTTTGGG + Intergenic
1009390059 6:63134687-63134709 TGCCTAAGCTCTCCACCTTTGGG + Intergenic
1010002986 6:70967086-70967108 TGGATAATCTCTGCCCATATTGG - Intergenic
1010778071 6:79909437-79909459 TGCTTATTTTCTTTCCCTTTTGG + Intergenic
1011571308 6:88738875-88738897 TGCATTATTTCTTCCTGTTTTGG - Intronic
1011996030 6:93589595-93589617 TGCATAATTGACTCCCCTTTTGG + Intergenic
1014270535 6:119330933-119330955 TCCTTACTCTCTACCCCTTTGGG + Intronic
1014822353 6:126005012-126005034 TGCTATGTCTCTTCCCCTTTGGG - Intronic
1014891935 6:126853857-126853879 AGCTTAATCTCTCCCACTTTAGG + Intergenic
1014971720 6:127824614-127824636 TGCAAAATATCTTCCTCTTTTGG - Intronic
1018325374 6:162662102-162662124 TTAATAATTTCTTTCCCTTTGGG + Intronic
1018611604 6:165653127-165653149 TTCATTATTTCTTTCCCTTTAGG + Intronic
1020355401 7:7270174-7270196 TGCAAAACCTATTCCCCTTTAGG + Intergenic
1022393922 7:29968585-29968607 TCCATGATCTTTTCCCCTATAGG - Intronic
1024328485 7:48132917-48132939 TGCCTAAACTCAACCCCTTTTGG - Intergenic
1024549178 7:50546539-50546561 TGGCTAAGCTCTTCCCCCTTGGG + Intronic
1030003821 7:105095557-105095579 TCCATTACCTCTACCCCTTTTGG + Intronic
1030751217 7:113235049-113235071 AGCTTAATCTCTCCCACTTTAGG - Intergenic
1030846868 7:114427803-114427825 TGAATAATGTCTTAACCTTTAGG + Intronic
1031005056 7:116460574-116460596 AGCTTAATCTCTCCCACTTTAGG + Intronic
1031796394 7:126180177-126180199 TGCAAAATTTCTTCACCTTTTGG - Intergenic
1032197517 7:129797961-129797983 TGCGTAACCTTTTCCCATTTGGG + Intergenic
1032362539 7:131269499-131269521 TGCATAATTTCATCACCTTAGGG + Intronic
1035019455 7:155792112-155792134 TCCATAATCCCTCCCCCTCTCGG + Intergenic
1038418732 8:27418195-27418217 TGAAAAATCCCTTCCCCATTAGG - Intronic
1040535390 8:48304762-48304784 TGCATAACATATTCCCCTCTTGG - Intergenic
1040836261 8:51734476-51734498 TGAATAATCTCTAACTCTTTAGG + Intronic
1041331789 8:56734609-56734631 TACATATTCTATTCCCCTTTAGG - Intergenic
1041802781 8:61817889-61817911 GGCAGAATCTCTTCTCCTTCTGG + Intergenic
1046112603 8:109744283-109744305 ATCATAGTCTCTTCCCCTTATGG + Intergenic
1046559567 8:115818845-115818867 AGCTTAATCTCTCCCACTTTAGG + Intergenic
1047641688 8:126827726-126827748 TGCATAATCTGCTCCCCCTAAGG - Intergenic
1047867310 8:129040668-129040690 TGTGTAATCTCCTCCCCTTGAGG - Intergenic
1048215718 8:132492871-132492893 TGGAAAATCTCTTACCCTCTAGG + Intergenic
1052841353 9:33293743-33293765 TGCTTAATTTTTTCCACTTTGGG + Intronic
1053105661 9:35405842-35405864 TACCTTATTTCTTCCCCTTTGGG - Intergenic
1055553801 9:77455471-77455493 TGCATAATCTCTTCCCCTTTGGG - Intronic
1056458890 9:86790346-86790368 TGCATAATATCATGCCCTATAGG - Intergenic
1057532830 9:95868720-95868742 TGCATATTCTCTTGCTTTTTAGG + Intergenic
1057812079 9:98265868-98265890 AGCTTAATCTCTCCCGCTTTAGG - Intergenic
1058457523 9:105151385-105151407 TGTATAAACTATTCCCCTCTTGG - Intergenic
1061936599 9:133861124-133861146 TGCAAAATCTCTTTCGATTTAGG - Intronic
1061958046 9:133973806-133973828 TGCATTTTGTCTTCCTCTTTAGG - Intronic
1186361560 X:8847193-8847215 TACATATTCTCTTTCCTTTTGGG + Intergenic
1186947911 X:14589936-14589958 TCCTTAATCACTTCACCTTTAGG - Intronic
1188860218 X:35246511-35246533 TGCATAATCTCTTTCCCTGTGGG - Intergenic
1189882404 X:45505891-45505913 TTCATAATATCTTCCCATTATGG + Intergenic
1192389291 X:70708454-70708476 TGTATAATCTGTTTTCCTTTGGG - Intronic
1192428805 X:71099102-71099124 TGCATAAACTCTTCAACCTTGGG - Intronic
1193130953 X:77919415-77919437 TTCCTAATCACTTCCCTTTTGGG + Intronic
1193976296 X:88123596-88123618 GACATAATCTCATTCCCTTTTGG - Intergenic
1194502575 X:94699403-94699425 AGCTTAATCTCTCCCACTTTAGG - Intergenic
1195948692 X:110243422-110243444 TGGGTAATCTTTTCTCCTTTGGG - Intronic
1196458535 X:115906628-115906650 TGCATAACCTCTTCCCAGTCTGG + Intergenic
1196974516 X:121143585-121143607 ACAATAATATCTTCCCCTTTGGG - Intergenic
1198154709 X:133947357-133947379 TGCATAATCTCCTCACCTCATGG + Intronic
1198667330 X:139038807-139038829 GACATGATCTCTTGCCCTTTTGG - Intronic
1200413175 Y:2881650-2881672 TGCATAATCTGTTACCCCTTTGG + Intronic
1202376541 Y:24243114-24243136 TGCCTAACCTCTTCCCATTTAGG - Intergenic
1202494239 Y:25427005-25427027 TGCCTAACCTCTTCCCATTTAGG + Intergenic