ID: 1055553802

View in Genome Browser
Species Human (GRCh38)
Location 9:77455472-77455494
Sequence CTGCATAATCTCTTCCCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055553802_1055553807 -5 Left 1055553802 9:77455472-77455494 CCAAAGGGGAAGAGATTATGCAG 0: 1
1: 0
2: 4
3: 22
4: 151
Right 1055553807 9:77455490-77455512 TGCAGGACGTGTACACCAGGGGG No data
1055553802_1055553804 -8 Left 1055553802 9:77455472-77455494 CCAAAGGGGAAGAGATTATGCAG 0: 1
1: 0
2: 4
3: 22
4: 151
Right 1055553804 9:77455487-77455509 TTATGCAGGACGTGTACACCAGG No data
1055553802_1055553809 26 Left 1055553802 9:77455472-77455494 CCAAAGGGGAAGAGATTATGCAG 0: 1
1: 0
2: 4
3: 22
4: 151
Right 1055553809 9:77455521-77455543 TCAGAATTCTGCCCAGCACATGG No data
1055553802_1055553806 -6 Left 1055553802 9:77455472-77455494 CCAAAGGGGAAGAGATTATGCAG 0: 1
1: 0
2: 4
3: 22
4: 151
Right 1055553806 9:77455489-77455511 ATGCAGGACGTGTACACCAGGGG No data
1055553802_1055553805 -7 Left 1055553802 9:77455472-77455494 CCAAAGGGGAAGAGATTATGCAG 0: 1
1: 0
2: 4
3: 22
4: 151
Right 1055553805 9:77455488-77455510 TATGCAGGACGTGTACACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055553802 Original CRISPR CTGCATAATCTCTTCCCCTT TGG (reversed) Intronic
902036056 1:13458997-13459019 CTGCAAAATCCGTTCACCTTTGG + Intergenic
905680220 1:39865188-39865210 CTTCATAATCACTCCCCTTTGGG + Intronic
906075132 1:43046494-43046516 CTTCTAAGTCTCTTCCCCTTGGG + Intergenic
906488326 1:46248154-46248176 CTGCTTGGTCTCTTCCTCTTTGG + Exonic
907368234 1:53980140-53980162 CTGCATCATTCCTTGCCCTTCGG + Intergenic
909016718 1:70388050-70388072 CTGAATAATTTCTTCCCCTCTGG + Intergenic
909272942 1:73647429-73647451 CATCAAAATCTCTCCCCCTTTGG - Intergenic
913578970 1:120207316-120207338 CTGCATGATCTCTTCAACTCAGG + Intergenic
913629203 1:120691053-120691075 CTGCATGATCTCTTCAACTCAGG - Intergenic
914560899 1:148818751-148818773 CTGCATGATCTCTTCAACTCAGG + Intronic
914611935 1:149311459-149311481 CTGCATGATCTCTTCAACTCAGG - Intergenic
914831144 1:151171801-151171823 CCCCATAATCTCCTCCCCATTGG + Intronic
915026740 1:152837661-152837683 CTCCCTAATCTCTTCCAGTTGGG - Intergenic
917814436 1:178693136-178693158 TTGCATAATTTCTTCCCGATGGG - Intergenic
918478697 1:184954015-184954037 ATACATAATCTTTCCCCCTTAGG - Intronic
918749315 1:188252178-188252200 CTTAATAATCACATCCCCTTAGG + Intergenic
920671412 1:208006333-208006355 TTGTGTAATCTCTTCCCCTTTGG + Intergenic
922414968 1:225413031-225413053 GTGCATAATACCCTCCCCTTAGG - Intronic
923311964 1:232743832-232743854 CTGCCCAGTCTCTTCCCCATTGG + Intergenic
924293356 1:242561012-242561034 ATGTATAATTTCCTCCCCTTGGG - Intergenic
924406375 1:243751754-243751776 CTGCAAGCTCTCTTCCCCTGTGG - Intronic
1063625954 10:7690320-7690342 CTTCATAATGTCTTCTCCTGTGG - Intergenic
1063946229 10:11178952-11178974 CTGCATCCTCTCTTGCCCTCTGG + Intronic
1068357460 10:55928294-55928316 TTGTATAATCTCTTCCCCTTGGG - Intergenic
1068782865 10:60940674-60940696 CTACATAATCTCTCCCTGTTGGG + Intronic
1069611633 10:69776530-69776552 TTTCCTAATCTCTTCCCCTGGGG - Intergenic
1071045867 10:81376098-81376120 CTGAACAATATCTTCCCCTTAGG - Intergenic
1073408413 10:103318943-103318965 GTGCATAATATCTTACCCTCTGG + Intronic
1078367066 11:10715578-10715600 CTGGAGATCCTCTTCCCCTTTGG - Intergenic
1080899206 11:36471867-36471889 CTGCAGAATGTCCTGCCCTTGGG - Intergenic
1080994175 11:37580175-37580197 CTTCATAACCTCTTCCACATAGG - Intergenic
1083294834 11:61709754-61709776 CTGCAGAACCTCTTCCCCTGGGG + Intronic
1087728732 11:101754234-101754256 CTGCATAATCTCCTCCAGATAGG + Intronic
1087896114 11:103588469-103588491 CTGGATAAACACTTCCTCTTAGG + Intergenic
1089326251 11:117659561-117659583 TTGCACAAACTCTTGCCCTTTGG - Intronic
1089798211 11:121000450-121000472 CTGCATAACCTTTTCCTATTCGG - Intergenic
1090637637 11:128700979-128701001 CTTCGTACTCTCTTCTCCTTAGG + Intronic
1092088233 12:5783435-5783457 CTTCATAATCTCTACCCCTAGGG + Intronic
1094269438 12:28596358-28596380 CTGCATCTGCTCTTCCCCATAGG - Intergenic
1094403819 12:30093176-30093198 CTGCTCAAGCTCTTGCCCTTTGG - Intergenic
1096539575 12:52297741-52297763 TTGCATTATCTCTTCCATTTAGG - Intronic
1096961533 12:55583164-55583186 CTATATAATCTCTTCCTTTTGGG - Intergenic
1098588063 12:72178672-72178694 CTGCAGAATCTATCCCACTTAGG + Intronic
1101718506 12:107331745-107331767 CTGCTCAATCTCCTTCCCTTTGG + Intronic
1103110141 12:118269697-118269719 ATGCATATTCTCTTCATCTTTGG + Intronic
1104163308 12:126201827-126201849 CTTCATATTCTCTTACCTTTTGG - Intergenic
1105621569 13:22072607-22072629 CTGCACCATCACATCCCCTTTGG + Intergenic
1105817646 13:24051513-24051535 GGGCATAATCTCCTCCCCTAAGG - Intronic
1107988584 13:45797335-45797357 CTGCATAATGCCTGCCGCTTGGG + Intronic
1109800818 13:67376182-67376204 CTGTATAATCCCTTCTCCTTGGG - Intergenic
1114259701 14:21027270-21027292 CTGTCTAAACTCTTTCCCTTTGG + Intronic
1114329619 14:21623407-21623429 ATGCAGAATTTCTTCCCCATAGG + Intergenic
1115044033 14:28967922-28967944 TTGTATAATGTCTTTCCCTTGGG + Intergenic
1115380944 14:32738315-32738337 ATGAATAATATCTTCCCATTTGG - Intronic
1117666910 14:58065670-58065692 GTGAGTAATCTCTTCCTCTTAGG + Intronic
1124824553 15:33080985-33081007 CTGCATCATCTCATCATCTTGGG - Intronic
1127669148 15:61178015-61178037 CTTCCTCATTTCTTCCCCTTTGG - Intronic
1127793997 15:62423032-62423054 CAGGATAACCTCTTCCCCCTGGG - Intronic
1130823817 15:87522957-87522979 CTACAAAATCTCTCCCCCTAGGG + Intergenic
1134644398 16:15854896-15854918 CTCCCAAATCTCTTCTCCTTAGG + Intronic
1136859420 16:33688526-33688548 CTGCATAAAATCTTCTCATTGGG + Intergenic
1138183622 16:54960011-54960033 CTGCTTACTCTTTTCCCATTGGG - Intergenic
1139461814 16:67128617-67128639 CTGCCACATCTCTTCCCCTCTGG + Intronic
1139970897 16:70774297-70774319 CTGCAGAATGTCTCCCCGTTTGG + Intronic
1140261346 16:73383108-73383130 CTGAATAATCTCTTCTCTTAAGG + Intergenic
1140538624 16:75734172-75734194 CTTCATACTCTCATCCTCTTTGG + Intronic
1141092319 16:81138684-81138706 ATCCAGTATCTCTTCCCCTTAGG + Intergenic
1141388868 16:83647793-83647815 GGACAGAATCTCTTCCCCTTTGG - Intronic
1141682546 16:85553149-85553171 CTGCATGATCTGTGCCCCTGGGG - Intergenic
1203120927 16_KI270728v1_random:1536715-1536737 CTGCATAAAATCTTCTCATTGGG + Intergenic
1143655783 17:8292813-8292835 CTTCATATCCTCTTTCCCTTGGG + Intronic
1144132982 17:12265979-12266001 CTTCATAATCTCTTGAACTTGGG - Intergenic
1147169115 17:38607718-38607740 CTGCTAATTTTCTTCCCCTTAGG - Intergenic
1149880346 17:60284032-60284054 CTTCAAACTCTCTTCTCCTTTGG - Intronic
1151076741 17:71282050-71282072 CTGCATAATCCGTTCCCCTTTGG - Intergenic
1153918347 18:9765976-9765998 GAGTATATTCTCTTCCCCTTAGG + Intronic
1155605084 18:27596048-27596070 CTGCTTCATCTCTTCCCCAGTGG + Intergenic
1155757978 18:29525756-29525778 CCTCATAACCTCTTCCTCTTTGG - Intergenic
1159137306 18:64351580-64351602 CTGCCTAATATCTTCACCCTGGG - Intergenic
1165178403 19:33947049-33947071 CTGCTTAGTCTCTTCTCCCTGGG - Intergenic
925395937 2:3533786-3533808 CTGCATTGTCTCTGCCTCTTGGG - Intronic
925999416 2:9318538-9318560 CAACATAATCTCCTTCCCTTTGG + Exonic
926542562 2:14199516-14199538 CTATATAATCCCATCCCCTTAGG - Intergenic
927532152 2:23816428-23816450 CTGCATATTATCTTACACTTTGG - Intronic
930666218 2:54101338-54101360 TTGCCTATTTTCTTCCCCTTGGG + Intronic
933037122 2:77413753-77413775 CTGCATAATTTCATTCCATTAGG - Intronic
935686920 2:105692048-105692070 ATGCATCACCTCTTCCCTTTGGG + Intergenic
937028035 2:118715272-118715294 CTGCATAATACCCTCCCCTTGGG + Intergenic
938262690 2:129906752-129906774 CTGCCCAAGCTCTTCCCCTCGGG - Intergenic
939126041 2:138178695-138178717 CTGCATAAATTCTTCTACTTTGG + Intergenic
939489016 2:142854531-142854553 CAGCATAATTGCTTCCCATTTGG + Intergenic
940599542 2:155840893-155840915 CAGCATAATTTTTTCCCCCTGGG - Intergenic
941317865 2:164017368-164017390 GTGTATAATCTCTTCCCCCAAGG - Intergenic
941516714 2:166489304-166489326 GTGCATAATGTTTTCCCCTCTGG + Intronic
942865089 2:180663887-180663909 CAGCATAATCTCTTCTCCCGTGG + Intergenic
943774241 2:191747903-191747925 CTGCATGATTTCTTACCTTTTGG - Intergenic
945146908 2:206748011-206748033 CTGAAGCATCTCTTCCCTTTGGG - Intronic
946362231 2:219225926-219225948 CTTCCTAACCCCTTCCCCTTCGG + Intronic
948122110 2:235538635-235538657 CTGCTTACCCTCTTCCTCTTTGG + Intronic
1171432545 20:25092276-25092298 CTGCAGAATCCTTTCCCCTTTGG - Intergenic
1171773577 20:29345995-29346017 CTCCATAATCCCTTCTCCTTTGG + Intergenic
1176942626 21:14942217-14942239 CTTCACTATCTTTTCCCCTTAGG - Intergenic
1183129715 22:35822407-35822429 CTGCATTATCTTTTGCCCCTAGG + Intronic
1183725189 22:39584652-39584674 CTAGAAACTCTCTTCCCCTTGGG - Intronic
1185081309 22:48710813-48710835 CTGCAGACTCCCTTTCCCTTGGG + Intronic
1185120144 22:48961176-48961198 CTGCATGCACTCTGCCCCTTGGG + Intergenic
949174806 3:1047587-1047609 CTGTATAATCTGTACCCCTTGGG + Intergenic
949905208 3:8853176-8853198 CTGTAAAATCTCCTCCCATTGGG + Intronic
957182198 3:76893174-76893196 TATCATCATCTCTTCCCCTTTGG + Intronic
957779443 3:84799515-84799537 TTACATAATTTCTTCCCCCTGGG + Intergenic
958455787 3:94328986-94329008 ATGCCTAATCACTTCCTCTTTGG - Intergenic
958894695 3:99816789-99816811 ATACATAATATCTTCCCTTTTGG + Intergenic
964025901 3:152073499-152073521 CTGCATAAAATCATCCCCCTGGG - Intergenic
964671321 3:159229489-159229511 CTTCTTAATAGCTTCCCCTTCGG + Intronic
966833100 3:184027863-184027885 CTGGAGAATCTCTGCCCCTTTGG - Intergenic
967169759 3:186813850-186813872 GTGGATAATCACCTCCCCTTCGG - Intergenic
970797583 4:19931950-19931972 CTCCTTAATCTCTTCCCATCTGG - Intergenic
974695132 4:65357911-65357933 CGGCATATTCTCTTCTCTTTTGG - Intronic
977092144 4:92691071-92691093 CTTCATTATTTCTTCCCATTAGG + Intronic
980854551 4:138423851-138423873 CTGAAAATTCTCTTCCTCTTGGG - Intergenic
981287685 4:143038893-143038915 CTGCATAACCTCTTCCTCTCTGG - Intergenic
989777766 5:45229997-45230019 CTGCTTAATATCATCACCTTGGG - Intergenic
990637504 5:57745923-57745945 CTGCTTCTTCTCTTCTCCTTAGG + Intergenic
990740336 5:58906145-58906167 TTGCACAATCTTCTCCCCTTTGG + Intergenic
993097177 5:83493198-83493220 CTGCAGAATCTACTCCCTTTAGG + Intronic
994515278 5:100764036-100764058 CTACATAATCTATTTCCCTTTGG - Intergenic
994817440 5:104601969-104601991 CTGTATAATCTCCTCCCCTTCGG - Intergenic
994940662 5:106319620-106319642 CTGCAGAATCTCTTTCCCAAGGG - Intergenic
996164519 5:120208888-120208910 CTGAAAAATCTCTTCTGCTTTGG - Intergenic
996652920 5:125903181-125903203 CAGCATAATCTCTTCCTATTTGG + Intergenic
998522829 5:142816379-142816401 CTGCTCAATCTCTTCCCCTAAGG + Intronic
998964874 5:147528280-147528302 CTGCATAGTTTCTCCCTCTTTGG - Intergenic
1001742001 5:174060963-174060985 CTGTATAATTTCCTCCCTTTAGG - Intronic
1001930148 5:175667056-175667078 ATGTATAATATATTCCCCTTTGG - Intronic
1002560413 5:180078049-180078071 CTGCAAGTTCTCGTCCCCTTGGG + Intergenic
1002924935 6:1599931-1599953 ATGCATAATTTCTTTCTCTTAGG - Intergenic
1003008485 6:2404208-2404230 GTGTATTATTTCTTCCCCTTTGG - Intergenic
1005229274 6:23681505-23681527 CTGTGTAATCTCTTATCCTTAGG + Intergenic
1007614677 6:43172809-43172831 CTGCAGAATCTCCTGCCGTTAGG + Intronic
1007901929 6:45421450-45421472 CTGCAAAATCTTTTTCCCTTGGG + Intronic
1010910920 6:81555228-81555250 TTGCATAATCTCTCACCATTTGG + Intronic
1013807711 6:114013252-114013274 TTTCATAATCTCTTCCACATAGG - Intergenic
1014270534 6:119330932-119330954 CTCCTTACTCTCTACCCCTTTGG + Intronic
1014788744 6:125646973-125646995 CTGCTTAATCTCTTCTGCTCTGG + Intergenic
1016692962 6:146960036-146960058 CTGCAAAATGACTTCCCCTTGGG + Intergenic
1018372700 6:163182917-163182939 CCGCAGATTCTCTTCCTCTTGGG - Intronic
1022974607 7:35545781-35545803 CTGCATACTCTCCTCACCTGGGG - Intergenic
1024517376 7:50270364-50270386 TTGTATAGTCTCCTCCCCTTGGG + Intergenic
1027720917 7:81740419-81740441 CTGCATAATCTTCTCCCCTTGGG + Intronic
1028138755 7:87248746-87248768 CTGCATAATCACTTCCTTTTAGG - Intergenic
1030585614 7:111414921-111414943 CTGAAGATTCCCTTCCCCTTGGG + Intronic
1032197516 7:129797960-129797982 CTGCGTAACCTTTTCCCATTTGG + Intergenic
1032362538 7:131269498-131269520 CTGCATAATTTCATCACCTTAGG + Intronic
1033562256 7:142543902-142543924 CTGCATATTTTATTCCCATTAGG - Intergenic
1038487509 8:27947348-27947370 AAGCAGAATCTCTTGCCCTTTGG - Intronic
1039689271 8:39846219-39846241 CTGCATATTCTCTTACAGTTGGG + Intergenic
1041491072 8:58433966-58433988 CTGGAAATTCTGTTCCCCTTAGG + Intronic
1042257340 8:66818491-66818513 CTGAATTATATCATCCCCTTAGG + Intronic
1042765012 8:72311888-72311910 GTGAGTCATCTCTTCCCCTTGGG - Intergenic
1044072018 8:87772760-87772782 CTGCATAAACACTTCACATTTGG - Intergenic
1044873715 8:96644757-96644779 TTTAATAATCTCTTCCCTTTGGG + Intergenic
1050185679 9:2970337-2970359 CTGCTTAAACTCTTGCTCTTTGG - Intergenic
1050360737 9:4828443-4828465 CTGCATAAACTCTTTTCCCTGGG + Intronic
1055158100 9:73089498-73089520 CTGTATGATTTCTTCTCCTTGGG + Intergenic
1055553802 9:77455472-77455494 CTGCATAATCTCTTCCCCTTTGG - Intronic
1058715920 9:107721979-107722001 GTGCTTTATCTCTTCCCATTAGG + Intergenic
1058876706 9:109250790-109250812 CTGCAAAAACTATACCCCTTGGG + Intronic
1059631306 9:116125727-116125749 CAGCATGTTCTCTTCTCCTTCGG + Intergenic
1060141238 9:121212106-121212128 ATCCATAGTCTCTTCCCCATCGG - Intronic
1187493251 X:19772618-19772640 CTGCAGAAACTCTTCTCCCTGGG - Intronic
1187870815 X:23763790-23763812 CTGCATAATCTCCTCCTATCCGG + Intronic
1188860219 X:35246512-35246534 GTGCATAATCTCTTTCCCTGTGG - Intergenic
1190533006 X:51399132-51399154 TGGTATAATCTCTTCCCATTGGG + Intergenic
1191221122 X:57989550-57989572 AGGCAGAATCTCTGCCCCTTGGG + Intergenic
1193174400 X:78375437-78375459 CTGCACAATCTCCTGCCCCTAGG + Intergenic
1194446509 X:93994064-93994086 CAGTATATTCTCTTCCCCTTAGG + Intergenic
1195994758 X:110720644-110720666 CTATAGAATCTCTTCCCTTTAGG - Intronic
1199748701 X:150794011-150794033 CTGCAAAATCCCTTCACCTTTGG - Intronic