ID: 1055553807

View in Genome Browser
Species Human (GRCh38)
Location 9:77455490-77455512
Sequence TGCAGGACGTGTACACCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055553802_1055553807 -5 Left 1055553802 9:77455472-77455494 CCAAAGGGGAAGAGATTATGCAG 0: 1
1: 0
2: 4
3: 22
4: 151
Right 1055553807 9:77455490-77455512 TGCAGGACGTGTACACCAGGGGG No data
1055553800_1055553807 1 Left 1055553800 9:77455466-77455488 CCACACCCAAAGGGGAAGAGATT 0: 1
1: 0
2: 2
3: 21
4: 167
Right 1055553807 9:77455490-77455512 TGCAGGACGTGTACACCAGGGGG No data
1055553799_1055553807 2 Left 1055553799 9:77455465-77455487 CCCACACCCAAAGGGGAAGAGAT 0: 1
1: 1
2: 3
3: 19
4: 197
Right 1055553807 9:77455490-77455512 TGCAGGACGTGTACACCAGGGGG No data
1055553794_1055553807 16 Left 1055553794 9:77455451-77455473 CCAACACTGTCCTGCCCACACCC 0: 1
1: 0
2: 5
3: 53
4: 509
Right 1055553807 9:77455490-77455512 TGCAGGACGTGTACACCAGGGGG No data
1055553801_1055553807 -4 Left 1055553801 9:77455471-77455493 CCCAAAGGGGAAGAGATTATGCA 0: 1
1: 0
2: 1
3: 22
4: 232
Right 1055553807 9:77455490-77455512 TGCAGGACGTGTACACCAGGGGG No data
1055553798_1055553807 6 Left 1055553798 9:77455461-77455483 CCTGCCCACACCCAAAGGGGAAG 0: 1
1: 0
2: 6
3: 35
4: 306
Right 1055553807 9:77455490-77455512 TGCAGGACGTGTACACCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055553807 Original CRISPR TGCAGGACGTGTACACCAGG GGG Intronic
No off target data available for this crispr