ID: 1055562480

View in Genome Browser
Species Human (GRCh38)
Location 9:77534795-77534817
Sequence GGCTCTTACTCTGCTCTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 182}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055562480_1055562486 28 Left 1055562480 9:77534795-77534817 CCTAAAAGAGCAGAGTAAGAGCC 0: 1
1: 0
2: 1
3: 15
4: 182
Right 1055562486 9:77534846-77534868 TTGGCTGTAGACAGTCAGGATGG No data
1055562480_1055562485 24 Left 1055562480 9:77534795-77534817 CCTAAAAGAGCAGAGTAAGAGCC 0: 1
1: 0
2: 1
3: 15
4: 182
Right 1055562485 9:77534842-77534864 TTTATTGGCTGTAGACAGTCAGG No data
1055562480_1055562483 -1 Left 1055562480 9:77534795-77534817 CCTAAAAGAGCAGAGTAAGAGCC 0: 1
1: 0
2: 1
3: 15
4: 182
Right 1055562483 9:77534817-77534839 CTAATAAAATATTCATGAATGGG No data
1055562480_1055562484 9 Left 1055562480 9:77534795-77534817 CCTAAAAGAGCAGAGTAAGAGCC 0: 1
1: 0
2: 1
3: 15
4: 182
Right 1055562484 9:77534827-77534849 ATTCATGAATGGGTGTTTATTGG No data
1055562480_1055562482 -2 Left 1055562480 9:77534795-77534817 CCTAAAAGAGCAGAGTAAGAGCC 0: 1
1: 0
2: 1
3: 15
4: 182
Right 1055562482 9:77534816-77534838 CCTAATAAAATATTCATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055562480 Original CRISPR GGCTCTTACTCTGCTCTTTT AGG (reversed) Intronic
903449217 1:23441536-23441558 GGCTACTGCTCTGCTCTTCTGGG - Intronic
906306969 1:44725529-44725551 GGCTCTTCCTCTGCCCCTCTGGG - Exonic
906575285 1:46884046-46884068 TGCTCTTTCTCTACTCTTCTTGG - Intergenic
906596691 1:47083849-47083871 TGCTCTTTCTCTACTCTTCTTGG + Intronic
909295298 1:73939736-73939758 TACTCTTACTCTGCTCTTCTGGG + Intergenic
910005822 1:82395940-82395962 GGCTTTTGCTGTTCTCTTTTGGG - Intergenic
911679765 1:100701942-100701964 GGCTGTAACTCTGAACTTTTTGG + Intergenic
914746750 1:150506923-150506945 TTCTCTTACTTTGCTCTTTCTGG - Exonic
915020785 1:152776742-152776764 GCCTCTAAATCTGCTCTTTTAGG - Intronic
915440363 1:155941979-155942001 GGCACTCACTCTCCCCTTTTGGG + Exonic
921506352 1:215975788-215975810 GGCTCTTTTTGGGCTCTTTTTGG + Intronic
924687384 1:246308328-246308350 GATTCTTACTTGGCTCTTTTAGG - Intronic
1065356788 10:24850245-24850267 GGCTCTTATTCAACCCTTTTTGG + Intronic
1065966943 10:30778409-30778431 GGCTTCTACTCTGCTCTCCTGGG - Intergenic
1067408728 10:46046491-46046513 CTCTCCTCCTCTGCTCTTTTAGG - Intergenic
1071810064 10:89169737-89169759 AGCTTTTACTCTGCTGTTTTGGG - Intergenic
1072447969 10:95515943-95515965 GGCAGCTACTCTGCTCTCTTGGG - Intronic
1072495539 10:95954332-95954354 GGATATTAGGCTGCTCTTTTGGG - Intronic
1072820658 10:98553812-98553834 GGCTCTTCCTGTGCTGTTTTGGG + Intronic
1074163195 10:110851260-110851282 AGCTCTGACTCTGCTCAGTTGGG + Intergenic
1074296506 10:112194197-112194219 GGCTCTTAATCCGCTTTGTTGGG + Intronic
1079466993 11:20740419-20740441 GGCTCTTGCTCCTCTCCTTTGGG + Intronic
1079467193 11:20742191-20742213 GGCTCTTGCTTGGCTCTGTTGGG + Intronic
1079802090 11:24882013-24882035 AGCTATGAATCTGCTCTTTTAGG + Intronic
1079962694 11:26943637-26943659 GGCTCCCACTCACCTCTTTTGGG - Intergenic
1080600379 11:33816565-33816587 GGTTCTTGCTCTGCTCCTCTGGG + Intergenic
1080713573 11:34774245-34774267 AACCCTTTCTCTGCTCTTTTTGG - Intergenic
1082181938 11:49130532-49130554 GGTTTTTAGTCTGCTCTGTTGGG - Intergenic
1082565136 11:54667925-54667947 TGCTCTTACTCTTCTCCTATGGG + Intergenic
1084181946 11:67451270-67451292 GGCTCTTTCACTGCTCTGGTGGG + Intergenic
1084302952 11:68263200-68263222 GACTTTTACTCTGATGTTTTGGG - Intronic
1085888732 11:80552297-80552319 ATCTCTTACTCAGCTTTTTTGGG - Intergenic
1087290206 11:96312991-96313013 GGCGCTAACACTGCACTTTTTGG - Intronic
1087578119 11:100015480-100015502 TGCTCTTACTCTGTGCTTATAGG - Intronic
1088872301 11:113901141-113901163 AGCTCATACTCAGTTCTTTTAGG - Intergenic
1090299553 11:125623717-125623739 GTCTCATACTCTGTTCTTATGGG + Intronic
1094276643 12:28684661-28684683 GGCTCCTACTTTCCTCTCTTTGG + Intergenic
1095912726 12:47445260-47445282 GGCTTTTGCACTGCTATTTTAGG + Intergenic
1098296703 12:69011375-69011397 GGCTCTTACGATGCTCTCCTTGG + Intergenic
1109765492 13:66890507-66890529 AATTCTTTCTCTGCTCTTTTGGG + Intronic
1110311961 13:74060196-74060218 GCCTCTAGCTTTGCTCTTTTTGG + Intronic
1116012922 14:39372004-39372026 GGCTCTAACTCTTCTGTCTTGGG + Intronic
1116013001 14:39373005-39373027 GGCTCTAACTCTTCTGTCTTGGG - Intronic
1116853560 14:49931887-49931909 AGCTCTTACTGAGCTCTTCTGGG + Intergenic
1117088781 14:52228555-52228577 GGCTTTTACTCTCCTCATTTTGG - Intergenic
1117721535 14:58633503-58633525 TGCTCTTACTCTGCTTTATTGGG - Intergenic
1117791824 14:59349826-59349848 GGCTCCTACTGTGCACTTTTAGG + Intronic
1118813553 14:69292625-69292647 GGCTCTTTCTCTGTTCTCTGGGG + Intronic
1119049903 14:71357078-71357100 GGGTCTTACTCTGGTCTCCTAGG + Intronic
1119165758 14:72491126-72491148 GGCTCTGACTTTGCTGTTGTGGG + Intronic
1122494003 14:102139463-102139485 CGCTCTTCCTCCGCTCTTTGGGG + Exonic
1122577328 14:102750677-102750699 GGCCCTGACTCTGCTCTTTAGGG - Intergenic
1123689627 15:22827207-22827229 GGCTATTTCTCTCCTCTTCTTGG + Exonic
1124893015 15:33750110-33750132 GGCTCTTCCTTTGCACTTCTGGG - Intronic
1128054074 15:64686917-64686939 GGCTCTCACATTGCTCTTTATGG - Intergenic
1131445559 15:92495705-92495727 GGTTCTTACTCTGCTCTTCTGGG + Intronic
1132863960 16:2084658-2084680 GGCTGTGGCTCTGCTCTTTAAGG - Exonic
1133234924 16:4383264-4383286 CGCTCTCCCTCTGCTCTTTCCGG - Exonic
1136072334 16:27795299-27795321 TGCTCAAACTCTCCTCTTTTGGG + Intronic
1137703438 16:50516895-50516917 TTCTCTTTCTCTGCTCTTTCAGG + Intergenic
1138768933 16:59638575-59638597 CTCTCTAACTCTGCTCCTTTAGG - Intergenic
1143054303 17:4151384-4151406 GGCTCTTATTCTTTTCTATTGGG - Intronic
1143477140 17:7209136-7209158 TGGTCTCCCTCTGCTCTTTTGGG + Intronic
1146172169 17:30642653-30642675 GGCTCTGACTCTGCTGTTGAGGG + Intergenic
1146969706 17:37062719-37062741 GCCTCAAACTCTGCTCTCTTTGG - Intergenic
1147660549 17:42114737-42114759 GGCTCTTGCTCTGCTCCCTTGGG - Intronic
1151602516 17:75114937-75114959 GGCACTTATTCTGCTGTTTCTGG + Intronic
1152053204 17:77998982-77999004 GGCTCTCACTATGCTGCTTTGGG + Intergenic
1203165426 17_GL000205v2_random:88916-88938 GCTTCTCACTCTGCTTTTTTGGG - Intergenic
1153494212 18:5681117-5681139 GTCTCCTACTCAGCTCTCTTTGG + Intergenic
1154075253 18:11194426-11194448 GACTCTTTCTCTTCTCTTTCTGG + Intergenic
1157937389 18:51888160-51888182 GTCTCTTTCTCTGCTGTCTTTGG - Intergenic
1159869134 18:73740808-73740830 GGCCCTGACTCTGCTCTCTAGGG - Intergenic
1160350647 18:78175277-78175299 GGCTCTTACTCAGCAGATTTGGG + Intergenic
1162990255 19:14297385-14297407 GGCTCTGACTCTGCTGTTGAGGG - Intergenic
1163318877 19:16560435-16560457 GACTCTTCCTCTGCTGTTTGAGG - Intronic
1166569258 19:43783258-43783280 GGCTCTTTCTCTGGTTCTTTGGG + Intergenic
925684538 2:6458106-6458128 CCCTCTTTCTCTTCTCTTTTTGG - Intergenic
926573512 2:14555435-14555457 AGCTCTGACTTTCCTCTTTTGGG - Intergenic
927442701 2:23130454-23130476 TGATCTTTCTGTGCTCTTTTTGG - Intergenic
928956489 2:36874443-36874465 CTCTCTTTCTCTTCTCTTTTTGG - Intronic
930666446 2:54103852-54103874 GGGGCTTATTCTGCTCTATTTGG - Intronic
931295570 2:60921375-60921397 ATCTCTTACTCTTCACTTTTAGG - Intronic
932509972 2:72276408-72276430 GGCTCTTTCTCTTATCATTTAGG + Intronic
935441218 2:103098199-103098221 CCCTCTTTTTCTGCTCTTTTGGG - Intergenic
937584281 2:123526942-123526964 GCCTCTTACTCTTCTATGTTTGG + Intergenic
939815504 2:146891619-146891641 GGCTCTTACTCTTCTAGATTTGG + Intergenic
940743858 2:157545117-157545139 GGCTCTTACTATAAGCTTTTGGG - Intronic
942850158 2:180474715-180474737 GGTTCTATCTCTGCTCCTTTTGG - Intergenic
944403958 2:199361048-199361070 CGCTCTTGCTCTCCTCTTTAAGG + Intronic
944749671 2:202696156-202696178 GGCTTGGAATCTGCTCTTTTTGG - Intronic
944856974 2:203777542-203777564 GTCTCTTCCTCTGCTTGTTTAGG - Intergenic
946963275 2:225008036-225008058 GGCTTTAACTCTACTCCTTTGGG - Intronic
1168844595 20:935270-935292 GGCTCAGAGTCTGCTCTGTTAGG - Intergenic
1169533888 20:6515697-6515719 GGCTCTATCTATGCTTTTTTTGG + Intergenic
1170172973 20:13435995-13436017 GCCTCTTTCTCTGCCCTTATTGG - Intronic
1171155169 20:22865320-22865342 GGATCTTATTTTGCTATTTTTGG - Intergenic
1171366792 20:24630515-24630537 GGCTGTTTCTCTGCTCTCCTGGG - Intronic
1173294261 20:41741975-41741997 GTCTCTGACTTTGTTCTTTTTGG + Intergenic
1175867496 20:62187846-62187868 GACGCTTACTTTGCTCTTTCTGG + Intronic
1176406326 21:6370163-6370185 GCTTCTCACTCTGCTTTTTTGGG + Intergenic
1178109765 21:29358120-29358142 GTCACTTCCTCTGCCCTTTTGGG + Intronic
1179083617 21:38196347-38196369 GGCTCTTCCTCTGCACAATTTGG + Intronic
1179180093 21:39037560-39037582 GGGGCTTTCTTTGCTCTTTTTGG - Intergenic
1183087453 22:35495233-35495255 TGCACTTGCTCTTCTCTTTTTGG - Intergenic
1184871132 22:47239145-47239167 GCAGCTGACTCTGCTCTTTTGGG + Intergenic
1185322895 22:50210055-50210077 GGCTCTCACTCTGCAGTTTCTGG - Intronic
950679142 3:14573131-14573153 TGCTCTTCCTCTGCACCTTTGGG - Intergenic
951349849 3:21593431-21593453 GGCTCTTACTCTATCCTTTGTGG + Intronic
956390308 3:68764958-68764980 GGCTGTCACTCTGCTTTTTCAGG - Intronic
956485333 3:69716535-69716557 AGCTCCAACTCTGCTCTCTTGGG - Intergenic
956589655 3:70900456-70900478 CTCTCTTCCTGTGCTCTTTTGGG + Intergenic
956726730 3:72162717-72162739 GGCTCTTCCTCCTCTCTCTTTGG + Intergenic
957077612 3:75614211-75614233 GGCTCTTACTCCCCTCATTGAGG + Intergenic
961155156 3:124673659-124673681 GGCTCTTACCATGCTCTATGAGG + Intronic
962603278 3:137011384-137011406 CCCTCTTAGTCTGCTCATTTAGG + Intergenic
963554043 3:146763283-146763305 AACTATTACTCTGCTGTTTTTGG - Intergenic
963801016 3:149676246-149676268 GTCTCTTTCCCTTCTCTTTTTGG - Intronic
967071483 3:185966314-185966336 GTCTCTTCTTCTCCTCTTTTTGG + Intergenic
967294153 3:187949183-187949205 GCCTCTTTCTTTGCTCTTTCAGG - Intergenic
968344094 3:197985907-197985929 TGCTCTTGTTCTCCTCTTTTAGG + Intronic
968711028 4:2117740-2117762 GGCCCTTAATCTGCTCCCTTGGG + Intronic
968874174 4:3256522-3256544 GGCTTTTATTCAGCTCTGTTTGG + Intronic
971141781 4:23932457-23932479 TGCCCCTACTGTGCTCTTTTAGG + Intergenic
971722958 4:30270556-30270578 GACTTTGACTCTGCTCTTGTAGG - Intergenic
972969566 4:44556040-44556062 GGCTCTTCCTCTCCTGTTTCTGG + Intergenic
973225619 4:47780516-47780538 GGATCTTACTTTGCTGTTCTGGG - Intronic
973602216 4:52553089-52553111 AGCTTTTACTTTGCTCTCTTGGG - Intergenic
976241133 4:82957862-82957884 GGCATTTTCTGTGCTCTTTTTGG - Intronic
980639977 4:135565234-135565256 TTCTCTTACTTTGCTCTTTTGGG + Intergenic
981483816 4:145263921-145263943 CTCTCTAACTCTGCCCTTTTGGG + Intergenic
983303886 4:165961523-165961545 GCCTCTGGCTCTGTTCTTTTTGG - Intronic
985421658 4:189790632-189790654 GGATTTTATTGTGCTCTTTTAGG + Intergenic
986201159 5:5580114-5580136 GGCTCCTTCTCAGCTCTCTTGGG + Intergenic
987836971 5:23174443-23174465 GCCTCTAGCTCTGTTCTTTTTGG + Intergenic
990789479 5:59460828-59460850 GCCTCTTGCTCTCCTCTTTAGGG - Intronic
995642100 5:114268574-114268596 CCTTCTTTCTCTGCTCTTTTTGG - Intergenic
997992773 5:138559855-138559877 GGCTCTTACCTGGCTCTTCTTGG + Exonic
998326603 5:141286498-141286520 AGTTCTTACTCTACTCATTTTGG - Intergenic
999587607 5:153108340-153108362 GTCTTTTTCTCTGCTCTCTTTGG - Intergenic
1000029219 5:157387612-157387634 TGTTCTTACTCTGTTCTATTTGG - Intronic
1002603618 5:180369469-180369491 AGCTCTTCCTCTGAACTTTTGGG - Intergenic
1003039095 6:2670572-2670594 GCCTCTTAGTCTTCTCCTTTAGG + Intronic
1004731712 6:18366072-18366094 GGCTTTAACTCTGCACTCTTTGG - Intergenic
1005456329 6:26023128-26023150 GCCTCTCATTGTGCTCTTTTTGG + Intergenic
1005496015 6:26388472-26388494 GGCTCCTACTCTTGTGTTTTGGG - Intronic
1007016548 6:38473534-38473556 GATTCCTACTCTGCTCTTATCGG + Intronic
1007969396 6:46035603-46035625 GGCTCTCACTTTGGTCATTTGGG + Intronic
1008800218 6:55359555-55359577 GGCTCTTCCGATGGTCTTTTGGG + Intronic
1008922570 6:56858117-56858139 GGCTCTCACTCTCTTCTGTTAGG + Intronic
1009689190 6:67005211-67005233 TGATCTTCCTTTGCTCTTTTTGG - Intergenic
1010917116 6:81633734-81633756 GTCTCTTATTCTCCTCTTTAGGG - Intronic
1011940409 6:92835794-92835816 GGCTCTGCCTCTGCTCCTTTTGG + Intergenic
1011966069 6:93158768-93158790 GCCTCTGGCTTTGCTCTTTTTGG + Intergenic
1012989677 6:105912160-105912182 GGTTCAGACTCTGCTTTTTTAGG + Intergenic
1016188498 6:141229384-141229406 GTCTCTTTCTTTGCTATTTTGGG + Intergenic
1018699281 6:166413686-166413708 GGCTCTTTCTCTGCACTCTGTGG + Intronic
1020660281 7:10973758-10973780 GGCTTTCACTCGGCTCTGTTCGG + Intergenic
1022628324 7:32061328-32061350 TGCCCTTTCTCTGCTCTTTAAGG - Intronic
1023816647 7:43955694-43955716 GGTTCCTTCTCTGCCCTTTTGGG - Exonic
1023848883 7:44139670-44139692 GGGCCTTACACTGCTCTTTGGGG - Intronic
1024261516 7:47577312-47577334 TCCTCTTCCTCTTCTCTTTTGGG - Intronic
1024342979 7:48285695-48285717 GGTGCATTCTCTGCTCTTTTAGG + Intronic
1024403884 7:48955023-48955045 GGCTCTATCTGTGCTCCTTTGGG - Intergenic
1024595362 7:50929359-50929381 GGTTTTTTCTCTCCTCTTTTTGG + Intergenic
1024626262 7:51210511-51210533 GGCTCTTGCTTTGCTCTCTCTGG + Intronic
1026790104 7:73325860-73325882 TGCTCTTACTCTCCTTTTTTTGG + Intronic
1028675639 7:93457504-93457526 GACTCTTTCTCTTCTTTTTTTGG - Intronic
1031361690 7:120856697-120856719 CGCCCTCAATCTGCTCTTTTGGG - Exonic
1032745803 7:134784751-134784773 GACTCTAACTCTACTCTCTTTGG - Intronic
1032895343 7:136244363-136244385 GTCTCTTTCTCTCCTCTTCTTGG - Intergenic
1037330247 8:17736881-17736903 GGCTCTTTCTCTTTTATTTTTGG + Intronic
1038765567 8:30424550-30424572 GGTTCATACTCTGCTCCGTTTGG + Intronic
1042828204 8:72999269-72999291 GGCTCTAACTCTTTTTTTTTTGG - Intergenic
1043304059 8:78771952-78771974 GGCACTTCCTCTCCTCTTTGGGG - Intronic
1045436461 8:102169581-102169603 GACTCTTACTCTCTTCTTGTTGG - Intergenic
1045755421 8:105535367-105535389 GGCTTTCACTCTACTCATTTAGG - Intronic
1045813943 8:106257864-106257886 TGCTGTTACCCTGTTCTTTTAGG - Intergenic
1046479037 8:114790260-114790282 GTCTCTCTCTCTGCTATTTTTGG - Intergenic
1047373958 8:124278632-124278654 GGCTCTGCCGCTGCTCTTTGAGG + Intergenic
1047765634 8:127987755-127987777 GGCTGTGCCTCTGCCCTTTTTGG + Intergenic
1050333514 9:4569069-4569091 GGCTCTTTTTTTGCTCTTTGTGG - Intronic
1051531580 9:18109873-18109895 GTCTGTCACTCTGCTCTCTTTGG - Intergenic
1053590318 9:39507205-39507227 GCCTCTTATTCTCCTCTTTTTGG + Intergenic
1053848072 9:42261366-42261388 GCCTCTTATTCTCCTCTTTTTGG + Intergenic
1054575985 9:66858084-66858106 GCCTCTTATTCTCCTCTTTTTGG - Intronic
1055480361 9:76703503-76703525 GGCTCTTACTCTTCTGTGATTGG + Exonic
1055562480 9:77534795-77534817 GGCTCTTACTCTGCTCTTTTAGG - Intronic
1056413197 9:86352899-86352921 ATCTCTTACTCTGATCTTTGTGG + Exonic
1059569250 9:115416476-115416498 TGCTCATACTCTGATCTGTTTGG - Intergenic
1059892125 9:118815286-118815308 GGCTTTTACTCTGCACTGTGTGG + Intergenic
1060113967 9:120926607-120926629 CGCTTTTGCTCTGCTCTGTTTGG + Exonic
1060518901 9:124282865-124282887 AGCCCTGGCTCTGCTCTTTTGGG + Intronic
1061751849 9:132783899-132783921 GGCTTTTACCTTACTCTTTTTGG - Intronic
1189712177 X:43824727-43824749 AGCTGTTACTCTGCTTTCTTTGG - Intronic
1199912373 X:152300915-152300937 ATCTCTTTCTCTTCTCTTTTTGG - Intronic
1202239956 Y:22756620-22756642 GGCTCATTCTCTGATATTTTTGG + Intergenic
1202392942 Y:24390382-24390404 GGCTCATTCTCTGATATTTTTGG + Intergenic
1202477843 Y:25279735-25279757 GGCTCATTCTCTGATATTTTTGG - Intergenic