ID: 1055562486

View in Genome Browser
Species Human (GRCh38)
Location 9:77534846-77534868
Sequence TTGGCTGTAGACAGTCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055562480_1055562486 28 Left 1055562480 9:77534795-77534817 CCTAAAAGAGCAGAGTAAGAGCC 0: 1
1: 0
2: 1
3: 15
4: 182
Right 1055562486 9:77534846-77534868 TTGGCTGTAGACAGTCAGGATGG No data
1055562481_1055562486 7 Left 1055562481 9:77534816-77534838 CCTAATAAAATATTCATGAATGG 0: 1
1: 0
2: 4
3: 41
4: 379
Right 1055562486 9:77534846-77534868 TTGGCTGTAGACAGTCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055562486 Original CRISPR TTGGCTGTAGACAGTCAGGA TGG Intronic
No off target data available for this crispr