ID: 1055563494

View in Genome Browser
Species Human (GRCh38)
Location 9:77545357-77545379
Sequence TCTTAGCTTTCCAAGGTGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 408}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055563494 Original CRISPR TCTTAGCTTTCCAAGGTGAA CGG (reversed) Intronic
901037704 1:6346350-6346372 TCTTAGCTTCCCAAAGTGCTGGG + Intronic
901714215 1:11140199-11140221 TCTCAGCTTTCTCAGGTTAAGGG + Intronic
902351271 1:15857178-15857200 TCTTAGCTTTCCAAGTAGCTAGG + Intronic
902611352 1:17599218-17599240 TCTTAGCCTTCCAAGTAGATGGG - Intronic
902711048 1:18240025-18240047 TCTCAGCTTTCCAAAGTGCTGGG - Intronic
903459544 1:23510817-23510839 TTTCAGTTTTACAAGGTGAAAGG + Intronic
904041037 1:27585308-27585330 TCCTAGCCTTCCAAGTTCAAAGG + Intronic
904091935 1:27951011-27951033 TCTTAGCCTCCCAAAGTGTAGGG + Intronic
904123129 1:28216256-28216278 TCATAACTTCCCAAGGAGAAAGG + Intronic
904123289 1:28217528-28217550 TCATAACTTCCCAAGGAGAAAGG + Intronic
904123448 1:28218813-28218835 TCATAACTTCCCAAGGAGAAAGG + Intronic
904537066 1:31206685-31206707 TCTCAGCCTTCCAAAGTGCAGGG + Intronic
905100151 1:35513362-35513384 TCTCAGCTTTCCAAAGTGCTGGG - Intronic
905931778 1:41792979-41793001 TCTGCTCTTTCCAATGTGAATGG + Intronic
906394581 1:45450916-45450938 TCTTAGCTTCCCAAAGTGCTGGG + Intronic
907356377 1:53878030-53878052 TCTTAGCCTTCCAAAGTGCTGGG + Intronic
907460663 1:54603666-54603688 TCTGAGCTTTCCCTGGTGTAGGG + Intronic
908498225 1:64716521-64716543 TCTCAGCTTCCCAAGGTGTTGGG + Intergenic
909430405 1:75581862-75581884 TCTTTGCTTTCCACTGTGACTGG + Intronic
910878340 1:91899265-91899287 CCTAAGCTTTCCAAAGTGCAGGG - Intronic
912870588 1:113301301-113301323 TCTTGGGTTTCCAAGCTGGATGG - Intergenic
914709623 1:150201045-150201067 TCTTGGCTTTCCAAAGTGCTGGG - Intergenic
914960995 1:152207350-152207372 TCTTTGCCTTCCAAGGGGTAAGG - Intergenic
915065257 1:153219623-153219645 TCCTTGCTTTCCAAAGGGAAAGG + Intergenic
915142978 1:153778341-153778363 TCCTGGCTTTACAAGGTGAGGGG + Exonic
915187229 1:154116476-154116498 TCTTGGCCTTCCAAAGTGCAAGG - Intronic
915531824 1:156507037-156507059 TCTTGGCTTTCCAAAGTGTTGGG - Intergenic
915780811 1:158547932-158547954 TCTTAGCTATCCACAGTGATGGG - Exonic
916133119 1:161629175-161629197 TCTTGGCTTTCCAAAGTGCTGGG - Intronic
917288019 1:173441845-173441867 GCTTAACTCTCCAGGGTGAAGGG + Intergenic
917385591 1:174470514-174470536 TCTCAGCTTTCCAAAGTGCTAGG - Intronic
917822059 1:178773050-178773072 TCTCAGCTTTCCAAAGTGCTAGG + Intronic
917858085 1:179118260-179118282 TCTTAGCCTTCCAAAGTGCTGGG - Intronic
918054524 1:181008205-181008227 TCTTAGCTTACCAAGTAAAATGG + Intronic
918722347 1:187868944-187868966 TCTTGGCTTTCCAAAGTGCTGGG + Intergenic
918952670 1:191160180-191160202 CCTGAGCTTTCCAAGGTGCTGGG - Intergenic
919680724 1:200432003-200432025 TCTCAGCTTCCCAAAGTGCAGGG - Intergenic
920109548 1:203577549-203577571 TCTTAGCTTCCCAAAGTGCTGGG - Intergenic
920930273 1:210381529-210381551 CCTTAGCTTTCCAAAGTGCTGGG + Intronic
921404125 1:214760283-214760305 TGTTAGTTTTCTAAGGTTAATGG + Intergenic
922054733 1:222030078-222030100 TATTTGCTTTTCAATGTGAATGG + Intergenic
923206005 1:231759588-231759610 ACTTAGCTTTCCAAGTAGATAGG - Intronic
1063529412 10:6816877-6816899 TCTTGGCTTCCCAAAGTGCAGGG + Intergenic
1064394577 10:14971134-14971156 TCTTGGCTTTCCAAAGTGTTGGG - Intronic
1064439189 10:15338081-15338103 CCTCAGGTTTCCAAAGTGAAAGG - Intronic
1066418534 10:35243103-35243125 TCTTAGCCTCCCAAAGTGCAGGG - Intergenic
1066584366 10:36915798-36915820 TCTACTCTTTCCAAAGTGAATGG - Intergenic
1068537423 10:58255733-58255755 TCTCAGCTTTCCAAAGTGTTGGG - Intronic
1070460411 10:76662441-76662463 TGTGAGCTTTCCAAGGTGGCTGG + Intergenic
1070668570 10:78362428-78362450 TCCTGGCTTTCCCAGGAGAAAGG - Intergenic
1071998824 10:91174254-91174276 CCTTAGCTTCCCAAAGTGATGGG - Intronic
1072639141 10:97197824-97197846 TCTCAGCCTTCCAAGGTGCTGGG - Intronic
1072765662 10:98093254-98093276 GTTTTGCTTTTCAAGGTGAATGG + Intergenic
1072882472 10:99241504-99241526 TCTTAGCCTTCCAAAGTGCTGGG - Intergenic
1072933789 10:99692449-99692471 ACTTAGCTTGCAAAGTTGAATGG + Intronic
1073364212 10:102924718-102924740 TCTGAGCCTTCCAAGGTGCTGGG + Intronic
1073675988 10:105647597-105647619 TCTTGGCCTTCCAAGAAGAAAGG - Intergenic
1074007760 10:109445690-109445712 TTTTGGCTTTCCAGGGAGAATGG - Intergenic
1074152802 10:110772919-110772941 TATCAGATTTCAAAGGTGAAGGG + Intronic
1076466482 10:130685966-130685988 CCTTGGCTTTCCAAAGGGAAAGG - Intergenic
1080770730 11:35338908-35338930 ACTGAGCTTTTCAAGATGAAGGG + Intronic
1082046386 11:47732490-47732512 TCTGAGATGTCAAAGGTGAAAGG + Intronic
1082074443 11:47965317-47965339 CCTTAGCCTCCCAAGGTGATGGG + Intergenic
1082264842 11:50107451-50107473 TCTTGGCTTTCCAAAGTGCTGGG - Intergenic
1083077856 11:60059652-60059674 TATTAGCTTTCTAAGGATAATGG + Intronic
1083830662 11:65230833-65230855 TCTCAGCTTTCCAAGTTGCCGGG - Intergenic
1084097934 11:66924709-66924731 TCTTAGCCTTCCAAAGTGATAGG + Intronic
1086381273 11:86257283-86257305 CCTTAGCTTTCCAAAGTGCTTGG + Intronic
1086457231 11:86971436-86971458 TCTCAGCTTCCCAAGGTGCTGGG - Intergenic
1086476844 11:87185731-87185753 TCTTATCTTTCCCATATGAAAGG - Intronic
1086518922 11:87646673-87646695 TCTTAGCCTCCCAAGGTGCTGGG + Intergenic
1087195727 11:95302677-95302699 TCTTGGCTTTCCAAAATTAAGGG - Intergenic
1087645611 11:100805027-100805049 ACTGAGCATTCCAAGGTGCAAGG + Intronic
1087676258 11:101165438-101165460 TCTTGGCCTTCCAAGGTGCTGGG + Intergenic
1088108879 11:106237906-106237928 TCTTAGCTTCCCAAAGTGCTGGG + Intergenic
1089186223 11:116616779-116616801 CCTTAGCTTTCCAAAGTGCTGGG - Intergenic
1091297011 11:134481129-134481151 TCTTCCCTTTCCAAGTTTAATGG + Intergenic
1094366148 12:29683957-29683979 TCTTAGCTTTCCAAGTAGCTGGG + Intronic
1095872579 12:47046591-47046613 TCTCAGCATTCCCAGGTGAAGGG + Intergenic
1096767112 12:53900265-53900287 TGTGAGCTTTCCAATGGGAAAGG + Intergenic
1096828448 12:54296829-54296851 TCTAAGCTATCCAAGCAGAAAGG - Intronic
1098339297 12:69435264-69435286 TCTGAGCTTTCCAACATTAAGGG + Intergenic
1098503325 12:71220058-71220080 TCCTTGCTTTCCAAGGTGAATGG + Intronic
1099125052 12:78744177-78744199 AATTATCTTTCCAAAGTGAAAGG + Intergenic
1099281759 12:80658584-80658606 TTTTAGAGTTTCAAGGTGAATGG - Intronic
1099449319 12:82789960-82789982 TCTTGGCCTTCCAAAGTGATGGG - Intronic
1099769114 12:87029704-87029726 TCTCAGCTTTTCCAGGTGCATGG + Intergenic
1099860106 12:88215804-88215826 TCTTGGCTTTCCAAAGTGCTGGG - Intergenic
1100280455 12:93113379-93113401 TCTCAGCTTCCCAAGGTGCTGGG + Intergenic
1100506050 12:95221311-95221333 GCTTAGCTTTCCAAAGTGCTAGG - Intronic
1100800781 12:98228155-98228177 TCTCAGCTTTCCAAGTAGATAGG + Intergenic
1101360698 12:104024129-104024151 TCTTGGCTTCCCAAAGTGCAGGG - Intronic
1102384154 12:112493307-112493329 TCTCAGCTTTCCAAAGTGGTGGG + Intronic
1102906099 12:116676250-116676272 CCTTAGCTTTCCAAAGTGCTGGG - Intergenic
1102977338 12:117216126-117216148 TCTTTGCCTTCCAAGGTGCTGGG + Intronic
1103509346 12:121463972-121463994 TCTTGGCTTTCCAAAGTGTTGGG - Intronic
1103689697 12:122761567-122761589 TCTTAGCTTCCCAAAGTGCTGGG - Intronic
1103762042 12:123257574-123257596 TCTTAGCCTCCCAAGGTGCTGGG - Exonic
1103812725 12:123628612-123628634 TCTTGGCTTTCCAAAGTGCTGGG + Intronic
1103999723 12:124852788-124852810 TCTTAGCTTCCCAAAGTGCTTGG - Intronic
1104297066 12:127526091-127526113 TCTTAGCTTCCCAAAGTGCTGGG - Intergenic
1104505888 12:129331862-129331884 ACTCAGCTTTCCAAGGAGAAAGG - Intronic
1105532019 13:21229058-21229080 TCTTAGCTTGCCCAGGATAAGGG - Intergenic
1105597068 13:21848914-21848936 TCTTGGCTTCCCAAGGTGCTGGG + Intergenic
1106936556 13:34728702-34728724 TCTTAGCTTCCCAAAGTGCTGGG - Intergenic
1110103290 13:71636032-71636054 TCTCAGCTTCCCAAAGTGCAGGG + Intronic
1112613937 13:100984002-100984024 TATGAGCTTTCAAGGGTGAAGGG - Intergenic
1112695233 13:101940409-101940431 CCTGTTCTTTCCAAGGTGAATGG + Intronic
1113374476 13:109751502-109751524 TTTTTGAGTTCCAAGGTGAAAGG + Intergenic
1113789973 13:113023101-113023123 ACTGAGCTGTCCCAGGTGAAGGG + Intronic
1114274159 14:21126786-21126808 CCTTGGCTTTCCAAGGTGCTGGG - Intergenic
1114448655 14:22809684-22809706 TCTTAGCTTCCCAAAGTGCTAGG + Intronic
1114768591 14:25403243-25403265 TTTTACCTTCCCAAGGAGAAAGG - Intergenic
1115232959 14:31181356-31181378 TCTTGGCTTCCCAAAGTGATGGG - Intronic
1115600497 14:34951136-34951158 TCTTGGCTTTCCAAAGTGCTGGG + Intergenic
1115845454 14:37526945-37526967 TGTTAGCCTTCCAGTGTGAAAGG + Intronic
1115923487 14:38405035-38405057 CTTTAGCTTTCCAAGGTAAAAGG + Intergenic
1116285241 14:42962655-42962677 ACTTAGATTTCCAAGGACAAGGG + Intergenic
1116722870 14:48523253-48523275 TCTTAGCTTGCCCAGATGCAAGG - Intergenic
1117402809 14:55372787-55372809 TCTTAGTTTTCCCAGGAGACAGG + Intronic
1117588595 14:57241102-57241124 TCTTGGCTTTCCAAAGTGCTGGG + Intronic
1117974357 14:61282474-61282496 TTTTAACTTTCCAAGTTCAATGG - Intronic
1119371518 14:74148959-74148981 TTTCAGCTTTCCATGGTGAATGG + Intronic
1119829741 14:77691144-77691166 TCTTTTTTTTCCAAAGTGAATGG - Intronic
1120097500 14:80404726-80404748 TCTTAGGTTTCCAGGGGAAAGGG - Intergenic
1120566454 14:86064826-86064848 TGTTAGTTTTCCAAGGAAAATGG - Intergenic
1121029807 14:90648465-90648487 TCTTAGCCTCCCAAGGTGCTGGG + Intronic
1121111289 14:91314884-91314906 TCTTAGCTTCCCAAAGTGTTGGG - Intronic
1121288013 14:92751632-92751654 TCTTAGCCTCCCAAAGTGATGGG - Intergenic
1121353773 14:93195972-93195994 TCTTAGCCTCCCAAGGTGCTGGG + Intronic
1121400082 14:93668458-93668480 CCTTGGCCTTCCAAAGTGAAGGG - Intronic
1122850752 14:104528973-104528995 TCTTGGCCTTCCAAGGTGCTGGG - Intronic
1124461227 15:29894206-29894228 CCTCAGCTTTCCAAGGTGCTGGG - Intronic
1124463253 15:29912457-29912479 TCTTGGCTTTCCAAAGTGCTGGG - Intronic
1125777873 15:42234451-42234473 TTCTAGGTTTCCAAGATGAATGG - Intronic
1126004604 15:44244204-44244226 TCTTAGCTTCCCAAGTAGATAGG + Intergenic
1127617944 15:60705935-60705957 TCTTAGGGTCCCCAGGTGAAAGG + Intronic
1128191210 15:65699926-65699948 CCTTAGCTTCCCAAGGTGCTGGG + Intronic
1128414215 15:67429261-67429283 TCTCAGCTTTCCAAAGTGCTGGG - Intronic
1128786415 15:70400664-70400686 CATTTGCTTTCCAAGGTGGAAGG + Intergenic
1129039998 15:72677509-72677531 CCTCAGCTTTCCAAGGTGCTGGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130816212 15:87436749-87436771 TCTCAGCTTTCCAAAGTGCTGGG - Intergenic
1130974644 15:88764055-88764077 TCTTAGCCTTCCAAAGTGCTGGG + Intergenic
1132823660 16:1891379-1891401 TCTTGGCTTCCCAAGGTGCTGGG - Intergenic
1134413940 16:14027924-14027946 TCTTAGCCTCCCAAGGTGCTGGG - Intergenic
1135104462 16:19635931-19635953 TCTTGGCTTCCCAAAGTGATGGG - Intronic
1135849280 16:25948400-25948422 TGTTAGCTTTGCAATGTGATGGG + Intronic
1136372834 16:29846925-29846947 TCTCAGCTTTCCAAAGTGCTGGG - Intronic
1137568456 16:49549202-49549224 TCTTGGCTTTGCCTGGTGAATGG + Intronic
1137911409 16:52381915-52381937 TCTCAGCTTCCCAAAGTGCAAGG + Intergenic
1137920206 16:52479704-52479726 TCATATCTTTCCATGGAGAAGGG - Intronic
1137981406 16:53073086-53073108 TTTTAGTTTTACAAGATGAAAGG - Intronic
1138718538 16:59052026-59052048 TCATATCTTCCCAAGGTTAATGG + Intergenic
1139479405 16:67221239-67221261 CCTTAGCTTCCCAAGGTGCTGGG - Intronic
1139772121 16:69286431-69286453 CCTTAGCCTTCCAAAGTGCAGGG - Intronic
1141227644 16:82133961-82133983 TCTTAAGTTTCCTTGGTGAAAGG - Intergenic
1141786869 16:86206870-86206892 TCTCAGCTTCCCAAGGTGTTGGG - Intergenic
1142802228 17:2353510-2353532 TCTCAGCCTTCCAAGGTGCTGGG - Intronic
1143161378 17:4873868-4873890 TCTCAGCTTCCCAAAGTGCAGGG + Intronic
1143580150 17:7820787-7820809 TCTCAGCTTTCCAAAGTGCTGGG - Intronic
1144771570 17:17762428-17762450 TCTTAGCTGTCTAAGGTTAGGGG - Intronic
1145406554 17:22602512-22602534 ACTGAGCATTCCAAGGTTAAGGG + Intergenic
1145934439 17:28706618-28706640 TGTCAGCTTTCCCAGGTGAGGGG + Intronic
1145953337 17:28837178-28837200 TCTCAGCCTTCCAAAGTGCAGGG - Intronic
1150414798 17:64978181-64978203 TCTTAGCTTCCCAAAGTGCTGGG - Intergenic
1151036352 17:70804902-70804924 TGTTAGTTTGCCAAGGTTAATGG - Intergenic
1155832716 18:30538455-30538477 TCTTAGCTTCCCAAAGTGCTAGG + Intergenic
1158148016 18:54337784-54337806 TCTTACCTTTACAAAGTGACTGG - Intronic
1158289290 18:55920648-55920670 ACTGAGCTATACAAGGTGAAAGG - Intergenic
1159255941 18:65945781-65945803 TCTTGGCTTCCAAAAGTGAAGGG + Intergenic
1159399441 18:67911606-67911628 TCTTTGCCTTCCACGGTGAGTGG + Intergenic
1159401602 18:67943876-67943898 TCTGGGCCTTCCAAGGTGATGGG - Intergenic
1160814039 19:1027153-1027175 TCTTAGCTTTGGGAGGGGAAGGG + Intronic
1160896621 19:1405683-1405705 TCTCAGCCTTCCAAGGTGCTGGG + Intergenic
1161300455 19:3539999-3540021 TCTTAGCCTTCCAAAGTGCTGGG - Intronic
1161503177 19:4628893-4628915 CCTTGGCTTTCCAAAGTGCAGGG + Intergenic
1162586958 19:11565800-11565822 TCTTAGCCTTCCAAAGTGCTGGG + Intronic
1162909353 19:13841061-13841083 ACCCAGCTTTCCAAGGTGAAGGG + Intergenic
1163138019 19:15327286-15327308 CCTTAGCTTTCCAAAGTGCTGGG - Intronic
1163700395 19:18783993-18784015 TCTTGGCTTTCCAAAGTGATGGG + Intronic
1164769371 19:30796237-30796259 TCTCAGCCTCCCAAGGTGCAGGG - Intergenic
1165922825 19:39309203-39309225 TCTTAGCCTTCCAAAGTGTTGGG - Intronic
1166059533 19:40317341-40317363 TCTCAGCTTTCCAAAGTGTTGGG - Intergenic
1167966127 19:53148734-53148756 ACTTGGCTCTCCAAAGTGAAAGG + Exonic
1168015219 19:53567594-53567616 CCTTAGCTTCCCAAGGTGCTGGG - Intronic
1168499898 19:56884827-56884849 TCTTTGATTTGCAGGGTGAATGG + Intergenic
926093843 2:10067655-10067677 TCTCAGCTTCCCAAAGTGTAGGG + Intronic
926752747 2:16211263-16211285 TGTTAGCTGTCCTAGGGGAAAGG + Intergenic
927887738 2:26728842-26728864 TCTTAGATTTTCAAAGGGAAGGG - Exonic
928405040 2:31008345-31008367 TCTTAGCTTCCCAAAGTGCTGGG + Intronic
929638989 2:43556812-43556834 TCTTGGCCTTCCAAAGTGATGGG - Intronic
930013856 2:46957570-46957592 TCTTAGCCTTCCAGGGTCAAGGG + Intronic
930306218 2:49677899-49677921 TCTCAGCTTTCCAAGGTGCTAGG + Intergenic
930854269 2:55995728-55995750 TCTTAGCCTCCCAAAGTGCAAGG - Intergenic
930921177 2:56755784-56755806 TCATTGCTTTCCAAGGAAAATGG - Intergenic
931980796 2:67692191-67692213 TCTCAGTTTTGCAAGATGAAAGG + Intergenic
932042707 2:68318213-68318235 TATTAGCCTTCCAAGGTGCAAGG - Intronic
932928705 2:76008027-76008049 TGGTAGCTTGCAAAGGTGAATGG + Intergenic
933314713 2:80702331-80702353 TCTTTGCCTTCCAAGGGCAAAGG - Intergenic
933948687 2:87309734-87309756 TCTTAGCCTTCTAAGTAGAAAGG + Intergenic
935419999 2:102857156-102857178 TCTCAGCTTCCCAAGGTGCTGGG + Intergenic
935964472 2:108460099-108460121 TCTCAGCTTTCCAAAGTGCTGGG + Intronic
936331511 2:111551862-111551884 TCTTAGCCTTCTAAGTAGAAAGG - Intergenic
936881851 2:117262603-117262625 TCTTAGATTCCCAGGGTGATGGG + Intergenic
937090107 2:119200641-119200663 ACTGAGCTTTGCAGGGTGAAAGG - Intergenic
937274009 2:120672744-120672766 TTTTAGTTTTGCAAGATGAAGGG - Intergenic
937666011 2:124487549-124487571 TGCTAGCTTCCCAAGGTAAATGG + Intronic
937742955 2:125377417-125377439 TCTTGGCCTTCCAAGGTGCTAGG - Intergenic
938206302 2:129427163-129427185 TCTTGGCTTCCCAAGGTGCTGGG - Intergenic
938290932 2:130150134-130150156 TCTTGGATGTCCAAGGGGAAAGG + Intergenic
938465613 2:131522820-131522842 TCTTGGATGTCCAAGGGGAAAGG - Intergenic
939910067 2:147970882-147970904 CCTTAGCTTTCCAAAGTGCTGGG - Intronic
940028773 2:149238225-149238247 GCTAAGCCTTCCAAGGTGGAAGG + Intergenic
940219556 2:151337437-151337459 TCTTAGCTTCCCAAAGTGCTGGG - Intergenic
941661165 2:168196799-168196821 TCTGAGCATTCTAAGATGAAGGG + Intronic
941744133 2:169068438-169068460 TCTTAGCTTACCAAGTTGCTGGG + Intronic
942036524 2:172015707-172015729 TCTTGGCTTTCCAAAGTGCTGGG - Intronic
942394931 2:175537079-175537101 TCTAAGGTCTCCAAGGTAAAAGG + Intergenic
942746218 2:179236235-179236257 TCTTAGCTTCCCAAAGTGCTGGG - Intronic
943743701 2:191438933-191438955 TCTTAGCTTCCCAAAGTGCTGGG - Intergenic
943943085 2:194023910-194023932 TTTTAGTTTTCCAAGGTAAAGGG + Intergenic
944208003 2:197177133-197177155 TCTTACGTTTCAAAAGTGAATGG - Intronic
944797494 2:203203001-203203023 TCTTACCTTTCCTAGGAAAACGG + Intronic
945287441 2:208096578-208096600 TCTAAGCTCTCTAAGGGGAAAGG + Intergenic
946430835 2:219626793-219626815 GCATAGCCTTCCAAGGGGAAGGG - Intergenic
947802449 2:232938641-232938663 TCTTAGCCTCCCAAGGTGCTGGG - Intronic
948623905 2:239255401-239255423 TCTTAGCTGTCAAAGGAAAAAGG - Intronic
1168784969 20:530723-530745 TCTTAGCCTTCCAAAGTGTTGGG + Intronic
1168907533 20:1418068-1418090 CCTTGGCTTTCCAAGTGGAAGGG - Intergenic
1169359138 20:4933351-4933373 TCTTAGCTTCCCAAAGTGCTGGG - Intronic
1170187559 20:13608025-13608047 TCTCAGCTTTAGAAGGTTAAAGG - Intronic
1170550799 20:17474422-17474444 TTTCGGCTTTCCAAGGTGCATGG + Intronic
1172288880 20:33760792-33760814 TCTCAGCTTTCCAAAGTGCTGGG + Intronic
1173487918 20:43455334-43455356 CCTCAGCTTCCCAAGGTGCAGGG + Intergenic
1173651510 20:44668591-44668613 TCTCAGCTTTCCAAAGTGCTGGG - Intergenic
1173965394 20:47108803-47108825 CCTCAGCTTTCCAAGGTGCTGGG + Intronic
1174142640 20:48426809-48426831 GCTTGGCTTTCCATGATGAAAGG - Intergenic
1174143995 20:48438013-48438035 TCTTGGCTTTCCAAAGTGCTGGG + Intergenic
1174228901 20:49027875-49027897 TCTTAGCTTTCCAAAGGAATGGG - Intronic
1177256701 21:18672498-18672520 TTTTAGCTTTCACAGGTGAGTGG - Intergenic
1178169133 21:30019047-30019069 TCTTAGATTTCCAAGAGAAATGG + Intergenic
1178348787 21:31855390-31855412 TCTCAGCCTTCCAAAGTGCAGGG + Intergenic
1178887998 21:36497455-36497477 TCTTTGCTTTCCAACAGGAAGGG + Intronic
1179662244 21:42884057-42884079 TATTAGGTTTCCAAGGTTCATGG + Intronic
1180864465 22:19108318-19108340 TCTCAGCTTTCCAAAGTGTTGGG - Intronic
1181295561 22:21835867-21835889 TGTCAGCTTTCCAGAGTGAAGGG - Intronic
1181931091 22:26402287-26402309 CCTTAGCTTTCCAAAGTGCTGGG - Intergenic
1183902944 22:41020118-41020140 TCTTGGCTTGCCAAGGTGCTGGG + Intergenic
1184015719 22:41784383-41784405 TCTCAGCTTTCCAAAGAAAAAGG + Exonic
1184199861 22:42961009-42961031 TCCTGGCTTGCCAAGGGGAATGG - Intronic
1184553283 22:45217108-45217130 CCTTAGCGTTCCAAGGTGCTGGG - Intronic
949500631 3:4677034-4677056 TCTTAGCTTTCCATGATCATTGG + Intronic
949878108 3:8640113-8640135 TTTCAGATTTACAAGGTGAAAGG + Intronic
950352767 3:12373380-12373402 TCTTATTTTTCTAAGTTGAAAGG - Intronic
950372129 3:12540033-12540055 TCTTAGCTTCCCAAAGTGCTGGG + Exonic
951003369 3:17590987-17591009 TCTCAGCCTTCCAAAGTGATGGG - Intronic
951348163 3:21571911-21571933 TCTTTGGTTTCAAAGGTGTAGGG - Intronic
951651066 3:24952122-24952144 TCTTAGCTTCCCAAAGTGCTAGG - Intergenic
952175402 3:30857327-30857349 TCTTAGATTTGCAAGGTAAAGGG + Intronic
952422209 3:33142546-33142568 TCTTTACTCTCCAAAGTGAAAGG + Exonic
952762636 3:36928212-36928234 TTTTTGCTTTGCAAGGTCAACGG - Intronic
953958926 3:47252346-47252368 TCTTAGCCTTCCAAAGTGCTGGG - Intronic
955036519 3:55273418-55273440 TCTAAGCTATCCAAGGTCATTGG + Intergenic
955452368 3:59083155-59083177 TCTTAGCCTTCCAAAGTGCTGGG + Intergenic
955507084 3:59643056-59643078 TTTTAGTTTTGCAAGATGAAAGG + Intergenic
956330683 3:68103534-68103556 TCTGAGCTTTTCTAGGTGACTGG - Intronic
958706277 3:97660366-97660388 TCATTTCTTTCCAATGTGAATGG - Intronic
958825361 3:99023314-99023336 GCTTAACTTTCCAAAATGAAAGG + Intergenic
958907839 3:99961469-99961491 TCTTAACTTTGCAAGGAGACAGG + Intronic
959178052 3:102942505-102942527 TCTTGACTTTTCAAGGTCAAAGG - Intergenic
960469064 3:118037853-118037875 TCATAGCCTTCACAGGTGAAAGG - Intergenic
960721716 3:120630952-120630974 TCTTAGTTTGCCAAGGATAATGG - Intronic
961855934 3:129871106-129871128 TCTCAGCTTTCCAAAGTGCTGGG - Intronic
962438397 3:135388372-135388394 TCTCAGCTTTCCAAAGTGCTGGG + Intergenic
962706784 3:138051458-138051480 TCTGAGCTTCCCAAGGTGCTAGG - Intergenic
963664954 3:148171268-148171290 TCTTATGTTTCCAAGATTAAGGG + Intergenic
963774935 3:149429061-149429083 TTTTAGCTTTCCAAAGGCAATGG - Intergenic
963857218 3:150267209-150267231 GTTTAGCTTTCCCAGGGGAAAGG - Intergenic
964217194 3:154299019-154299041 TCTCAGCTTTCCAAAGTGCTGGG - Intronic
965729108 3:171751748-171751770 TCTTGGCTTTCCAAAGTGCTGGG - Intronic
965934462 3:174090218-174090240 CCTCAGCTTTCCAAAGTGCAAGG - Intronic
966896137 3:184446599-184446621 CCTTAGCTTCCCAAAGTGCAGGG + Intronic
967482231 3:189986683-189986705 TCTTAGCTTTTTGAGGTAAATGG + Intronic
968673960 4:1867040-1867062 TCTTAGGTTGCCAGGGAGAATGG + Intergenic
969581045 4:8065671-8065693 TCTTAGCCTTCCAAAGTGCTGGG - Intronic
970422118 4:15915020-15915042 TCTGAGCTATCCACAGTGAAGGG + Intergenic
971811826 4:31437884-31437906 TCTCAGCTTCCCAAAGTGCAGGG - Intergenic
973561503 4:52141431-52141453 TGTTAGTTTGCCAAGGTTAATGG - Intergenic
974808533 4:66915506-66915528 CATTTGTTTTCCAAGGTGAATGG - Intergenic
974928509 4:68332320-68332342 GCTTAGCCTTCCAGGTTGAATGG - Intronic
975773138 4:77751919-77751941 TCTCAGCCTTCCAAGGTGCTGGG - Intronic
975817648 4:78235696-78235718 CCTTAGCTTTCCAAAGTGCTGGG - Intronic
976267328 4:83196317-83196339 CCTTAGCTTTCCAAAGTGCTAGG - Intergenic
976743190 4:88378189-88378211 CCTCAGCTTTCCAAAGTGCAGGG - Intergenic
977022265 4:91772835-91772857 CCTTAGCTTCCCAAAGTGCAGGG + Intergenic
977432240 4:96944762-96944784 TCTAAGTTTTCCAAGGTGGGAGG + Intergenic
977887877 4:102273165-102273187 TCTTAGCTTTCCAGGCTCCATGG - Intronic
978541089 4:109816741-109816763 TCTTAGCTTCCCAAAGTGTTGGG - Intronic
978808404 4:112824450-112824472 CCTTAGCTTTCCAAAGTGCTGGG + Intronic
979928339 4:126596222-126596244 TCTTAGCTTTCTAAAGTGTTGGG - Intergenic
980103421 4:128564467-128564489 TCATAGCTTTGCAGGGAGAATGG + Intergenic
981611406 4:146597438-146597460 TCTTGGCTTTTCCAGGTGCATGG + Intergenic
982971413 4:161992590-161992612 TCTTGGCTTTCCAAAGTGCTGGG - Intronic
983083068 4:163411784-163411806 TATTGGCTTTCCAACGTAAAAGG - Intergenic
983644791 4:169978719-169978741 TCTCAGCTTTCCAAAGTGCTGGG + Intergenic
983813690 4:172096343-172096365 TCTCAGCTTTCCAAAGTGTTGGG + Intronic
984502364 4:180572289-180572311 GCTTTGCTTTACAAAGTGAAAGG + Intergenic
984672401 4:182505704-182505726 TCTTGGCCTTCCAAGGTGCTGGG + Intronic
987405524 5:17520473-17520495 CCTTGGCTTCCCAAAGTGAAGGG - Intergenic
987405969 5:17523907-17523929 CCTTGGCTTCCCAAAGTGAAGGG - Intergenic
987406418 5:17527341-17527363 CCTTGGCTTCCCAAAGTGAAGGG - Intergenic
987407026 5:17581596-17581618 CCTTGGCTTCCCAAAGTGAAGGG + Intergenic
987407280 5:17583630-17583652 CCTTGGCTTCCCAAAGTGAAGGG + Intergenic
987407729 5:17587064-17587086 CCTTGGCTTCCCAAAGTGAAGGG + Intergenic
987407980 5:17588832-17588854 CCTTGGCTTCCCAAAGTGAAGGG + Intergenic
987408427 5:17592266-17592288 CCTTGGCTTCCCAAAGTGAAGGG + Intergenic
987410412 5:17609683-17609705 TCTTGGCTTCCCAAAGTGAAGGG - Intergenic
987863206 5:23510309-23510331 TCTTGGCCTTCCAAGGTGCTGGG + Intronic
988271240 5:29020611-29020633 TCTTAGCTTTCCCAGATGTGAGG - Intergenic
988395203 5:30688306-30688328 TATGAGCTTTCCAAGGTATAAGG - Intergenic
988541955 5:32118400-32118422 TCTTAGCTTCCCAAAGTGCCGGG - Intergenic
989454756 5:41630425-41630447 TCTTCCCTTTCAAATGTGAAAGG + Intergenic
990104528 5:52241612-52241634 TTTTAATTTTCCAAAGTGAATGG + Intergenic
990335952 5:54772940-54772962 TCTTAGAGTTTCAAGGTGAAGGG + Intergenic
991298597 5:65105773-65105795 TCTTATCTCTCCAAGGGGAGAGG + Intergenic
991760071 5:69911290-69911312 CCTTAGCCTCCCAAGGTGTAGGG + Intergenic
991839301 5:70786341-70786363 CCTTAGCCTCCCAAGGTGTAGGG + Intergenic
991882147 5:71225229-71225251 CCTTAGCCTCCCAAGGTGTAGGG - Intergenic
994023332 5:95052973-95052995 TAGTAACTTTCCAAGGTAAAGGG - Intronic
995184054 5:109253345-109253367 TCCAAGCTGTTCAAGGTGAAAGG + Intergenic
995617977 5:113988585-113988607 TTTCAGCTTACCAAGATGAATGG - Intergenic
996076043 5:119195607-119195629 TTTCAGCTTTGCAAGATGAAAGG + Intronic
997098047 5:130936144-130936166 TCTTGGCTTTCCAAAGTGCTGGG - Intergenic
997099037 5:130947552-130947574 TCTCAGCTTTCCAAAGTGCTGGG - Intergenic
997318296 5:132956378-132956400 CCTTAGCCTTCCAAGGTGCTGGG - Intronic
997997646 5:138599337-138599359 CCTTAGCTTCCCAAAGTGATGGG - Intergenic
999587648 5:153108675-153108697 TCTTGGCTTTCCAAAGTGCTGGG + Intergenic
1000717345 5:164662176-164662198 TCTCAGCCTTCCAAGGTGCTGGG - Intergenic
1001408830 5:171496056-171496078 TCTTAGCACCACAAGGTGAAAGG - Intergenic
1004761262 6:18669178-18669200 TCAGAGCTGTCCAAGGTGAAAGG + Intergenic
1004913076 6:20305760-20305782 CCTTAGCTTCCCAAAGTGCAGGG + Intergenic
1006527115 6:34616026-34616048 TCTGGGCTTCCCAAGGGGAAAGG + Intronic
1006590867 6:35156069-35156091 TCTCAGCCTTCCAAGGTGTTGGG + Intergenic
1008102416 6:47406197-47406219 TCTTAGCCTTCCAAAGTGCTGGG - Intergenic
1008766366 6:54921097-54921119 TTTTAGCCATCCAAGGTGAAAGG - Intronic
1008837906 6:55860023-55860045 TCTTAGCTTCCCAAAGTGCTGGG - Intronic
1010091946 6:71992909-71992931 TCTTGGCCTTCCAAAGTGCAGGG + Intronic
1011088044 6:83564613-83564635 TCTTAGCTTTCCAAAGTACTGGG + Intronic
1011849668 6:91610750-91610772 TCTTTGTTTTCCAAGGTAATAGG - Intergenic
1012469472 6:99554867-99554889 TCTTGGCTTTCTCAGCTGAAAGG - Intronic
1013517358 6:110900580-110900602 TCTTAGCCTCCCAAGGTGCTAGG + Intergenic
1013545588 6:111153810-111153832 TCTTATCTTTGTAAGGAGAAAGG - Intronic
1015174443 6:130291353-130291375 TCTTAGCCTTCCAAAGTGCTGGG + Intronic
1015348328 6:132186221-132186243 TCTTAGAATTCCATGCTGAATGG - Intergenic
1015411308 6:132896977-132896999 TGTTAGCTTTCCCAGAGGAAAGG + Intergenic
1016268059 6:142255443-142255465 ACTTAGCTTCCCAAGGTGCTGGG - Intergenic
1016714243 6:147204668-147204690 TTTCAGCTCTGCAAGGTGAACGG + Exonic
1018339220 6:162831777-162831799 AGTTAGTTTTCCAAGGTTAATGG + Intronic
1019778210 7:2924882-2924904 TCTTGGCTTTCCAAGGAGCTGGG + Intronic
1021294681 7:18889948-18889970 TCTTAGCCTTCCAAAGTGTTGGG + Intronic
1022264786 7:28743280-28743302 TCTTAGCCTCCCAAAGTGCAGGG - Intronic
1022269447 7:28792052-28792074 CCTTAGCCTTCCAAGGTGCTGGG - Intronic
1024041752 7:45561379-45561401 TTTTAGCTTGACAAGGTCAAGGG + Intergenic
1024501336 7:50111183-50111205 TCTTAGTTTTCCATGGCCAAGGG - Intronic
1024968798 7:55050195-55050217 TTTCAGCTTTGCAAGATGAAAGG - Intronic
1025702607 7:63833881-63833903 TCTTAGCCTTCCAAAGTGCTAGG + Intergenic
1026171827 7:67960665-67960687 TCTTAGCCTTCCAAAGTGCTAGG + Intergenic
1026429347 7:70328174-70328196 TTTTAGTTTCCCAAGCTGAAAGG - Intronic
1027153105 7:75746933-75746955 TCTTAGCTTTCCAAGTAGCTGGG - Intergenic
1028488867 7:91389053-91389075 TCTTAGCCTTCCAAAGTGCTAGG - Intergenic
1030251039 7:107445057-107445079 TCTCAGCTTTCCAAGTTGCTGGG - Intronic
1030913212 7:115278745-115278767 CCTTAGCTTTCCAAAGTGCTGGG + Intergenic
1032538925 7:132687409-132687431 TCTCAGCACTCCGAGGTGAATGG - Intronic
1032556754 7:132844047-132844069 CCTTAGCTTCCCAAGGTGTTGGG - Intronic
1033767488 7:144509862-144509884 TCTTGGCTTTCCAAAGTGCTGGG + Intronic
1034587827 7:152111403-152111425 CCTTAGCTTCCCAAGGTGTTAGG + Intronic
1034857062 7:154560631-154560653 TCTCAGCCTTCCAAAGTGATGGG - Intronic
1035854339 8:2958177-2958199 TGTTAGCATTCCAAGGGGATTGG + Intronic
1037576447 8:20208957-20208979 TCTTAGCTTCCCAAAGTGCTGGG + Intronic
1039426301 8:37489115-37489137 TCTTAGCTTGCTCAGTTGAAGGG - Intergenic
1042121934 8:65497970-65497992 TCTTGGCTTTCCAAAGTGCTGGG - Intergenic
1043863235 8:85346509-85346531 TCTCAGCTTCCCAAGGTGCTGGG - Intronic
1044267542 8:90201043-90201065 TCTTTGCTTTCACAGGAGAAGGG - Intergenic
1045219043 8:100179130-100179152 CCTTGGCTTTCCAAGGTGCTGGG - Intronic
1047057065 8:121177132-121177154 TCCTACCTTTCCAACGTCAATGG + Intergenic
1047280412 8:123440404-123440426 TCTTAGCTTCCCAAAGTGCTGGG + Intronic
1047705256 8:127492813-127492835 TTTTGGCTTTTGAAGGTGAAAGG - Intergenic
1047747930 8:127859056-127859078 TCTTAGCTTCCCAAAGTGCTGGG + Intergenic
1047859621 8:128950899-128950921 TCTCACCTTTCAAAGGTGAGAGG + Intergenic
1048680234 8:136833189-136833211 CCTTAGCTTCCCAAAGTGATGGG - Intergenic
1049679929 8:143913598-143913620 TGTTGTCTTTCCAAGGGGAAGGG - Intergenic
1051335874 9:16065443-16065465 CTCGAGCTTTCCAAGGTGAAAGG - Intergenic
1051432486 9:16994192-16994214 TCTTGGCCTTCCAAAGTGCAGGG + Intergenic
1052287584 9:26804098-26804120 TCTCAGCCTTCCAAAGTGACGGG - Intergenic
1052524850 9:29602791-29602813 TCTCAGCCTCCCAAAGTGAAGGG + Intergenic
1052530535 9:29678217-29678239 TTTTAGTTTTGCAAGATGAAAGG + Intergenic
1052571684 9:30232975-30232997 TAATCGCTTTCCAAAGTGAAAGG + Intergenic
1053115996 9:35503110-35503132 CCTTAGCTTCCCAAAGTGCAGGG + Intronic
1055563494 9:77545357-77545379 TCTTAGCTTTCCAAGGTGAACGG - Intronic
1055651592 9:78411520-78411542 TCTCAGCTTTTCAAGGGGATGGG + Intergenic
1056483866 9:87034613-87034635 TATTAGCTGACAAAGGTGAATGG + Intergenic
1056775614 9:89510319-89510341 TCTTAGCTTCCCAAAGTGTTGGG + Intergenic
1056780766 9:89548682-89548704 CCTCAGCTTCCCAAGGTGCAGGG - Intergenic
1057419520 9:94899497-94899519 TCTTAGCTTCCCAAAGTGCTGGG - Intronic
1058960854 9:109991487-109991509 TCTTGGCCTCCCAAGGTGTAAGG + Intronic
1059241889 9:112813211-112813233 TCTCAGCCTTCCAAAGTGATGGG - Intronic
1060257884 9:122048415-122048437 TCTTGGCTTTCCAAAGTGCTGGG + Intronic
1061848038 9:133399102-133399124 TCTTGGCTTTCCAAAGTGTTGGG + Intronic
1062304064 9:135892451-135892473 ACTTAGCTTTCCAAAGTGCTGGG - Intronic
1186766560 X:12776424-12776446 TCTTAGCCTCCCAAAGTGCAGGG - Intergenic
1186959559 X:14721002-14721024 CCTTAGCCTCCCAAGGTGGACGG - Intronic
1188188959 X:27150316-27150338 TCTGAGCTTTCCAAGGTATTAGG - Intergenic
1188856045 X:35197162-35197184 TATTAGCTTGCCCAGGTGCAGGG + Intergenic
1189766861 X:44380989-44381011 CCTCAGCTTTCCAAGGTGCTGGG - Intergenic
1189884337 X:45525429-45525451 CTTTAGCTATCCATGGTGAAAGG + Intergenic
1190818968 X:53955327-53955349 TCTTACCTTTCCAAAGTGCTAGG + Intronic
1190833614 X:54080917-54080939 TCTTGGCTTTCCAAAGTGCTGGG - Intronic
1192103433 X:68290207-68290229 CCTCGGCTTTCCAAAGTGAAGGG - Intronic
1192158334 X:68763463-68763485 TCTGAGACTGCCAAGGTGAAAGG + Intergenic
1193909201 X:87281002-87281024 TCTTAGCTTTCCAGGTTCCATGG + Intergenic
1195508108 X:105682007-105682029 TGATAGCTTTCAAAAGTGAAAGG + Intronic
1195920780 X:109981557-109981579 TCTTAGCTTCCCAAAGTGCTGGG - Intergenic
1196666395 X:118321633-118321655 TCTTGGCTTCCCAAAGTGATGGG - Intergenic
1196859311 X:120012595-120012617 TTTCAGCTTTCTAAGGTGAGTGG + Intergenic
1201559479 Y:15300883-15300905 CCTTAGCTTTCCAAAGTGCCAGG + Intergenic