ID: 1055566912

View in Genome Browser
Species Human (GRCh38)
Location 9:77578899-77578921
Sequence TTGGATGCCCATCAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055566912_1055566915 -7 Left 1055566912 9:77578899-77578921 CCTTCCACTTGATGGGCATCCAA 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1055566915 9:77578915-77578937 CATCCAAAACACAGACTTGTGGG No data
1055566912_1055566920 22 Left 1055566912 9:77578899-77578921 CCTTCCACTTGATGGGCATCCAA 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1055566920 9:77578944-77578966 CAATGCTGTGGCCCTTATCTCGG No data
1055566912_1055566914 -8 Left 1055566912 9:77578899-77578921 CCTTCCACTTGATGGGCATCCAA 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1055566914 9:77578914-77578936 GCATCCAAAACACAGACTTGTGG No data
1055566912_1055566917 10 Left 1055566912 9:77578899-77578921 CCTTCCACTTGATGGGCATCCAA 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1055566917 9:77578932-77578954 TGTGGGCCTAACCAATGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055566912 Original CRISPR TTGGATGCCCATCAAGTGGA AGG (reversed) Intronic
900642822 1:3695479-3695501 ATGGATGCCCACCATGCGGAGGG - Intronic
900759155 1:4459512-4459534 TTGGATTCCAATCAAATGGTCGG + Intergenic
902454734 1:16524534-16524556 GTGGAATCTCATCAAGTGGATGG + Intergenic
905651460 1:39659793-39659815 TTCGATGCCCATCAACAGGGGGG + Intronic
909264059 1:73533998-73534020 TTTGATGCCTATCATGTTGAGGG + Intergenic
920501483 1:206488123-206488145 TTGGAGGCCCACTAAGCGGATGG + Intronic
1065298816 10:24302282-24302304 TTGGATGTCCATCATGGGTAAGG + Intronic
1068667286 10:59690404-59690426 TTGGGTGCCATACAAGTGGATGG + Intronic
1072831715 10:98664645-98664667 TTGGATTACCATCCAGTAGATGG - Intronic
1079239450 11:18712310-18712332 TTGTGTGCACATGAAGTGGAAGG - Exonic
1079525909 11:21387356-21387378 GTGGGTGACCATCAAGTGGGAGG - Intronic
1081407401 11:42714010-42714032 TTGGATGCACATCTATTGCATGG - Intergenic
1082781997 11:57294981-57295003 TGGGAAGCCCCTGAAGTGGAGGG - Intergenic
1084397401 11:68921764-68921786 ATGGATGCCTTTCAGGTGGAAGG - Intronic
1085836858 11:79966314-79966336 TTGAATCCCCATCACGTGGTAGG + Intergenic
1086590184 11:88506431-88506453 TTGGATCCTCATCAAAAGGATGG - Intronic
1089906731 11:122047819-122047841 TTGCATTCCCACCAAGAGGAAGG + Intergenic
1090527945 11:127557673-127557695 TTGTATGCCCATCAACTCGGAGG - Intergenic
1091915548 12:4270068-4270090 TAGGAGGCACATCAAGAGGAAGG - Intergenic
1095130779 12:38539888-38539910 TTGAATGCCTATCATGTGGCAGG + Intergenic
1098744402 12:74217698-74217720 TTGGAATCCCATCAACTGAATGG + Intergenic
1099572509 12:84341750-84341772 TTGGATGCCCAGGAAGTAAAAGG - Intergenic
1101361055 12:104027444-104027466 TAGGATGTCCAGGAAGTGGATGG - Intronic
1101605179 12:106243035-106243057 TGGGATGCCCACTAAGTGGTAGG + Intronic
1102913207 12:116734571-116734593 TTGGATTCCCATGAAGTGGCTGG + Intronic
1107730744 13:43345914-43345936 TCCGATGCCCCTCCAGTGGAGGG - Intronic
1114473293 14:22978206-22978228 TTGGATCCCCACCAAGTGTCTGG - Intronic
1120900738 14:89573587-89573609 TTGGACTCCCATCCCGTGGATGG - Intronic
1128220372 15:65964492-65964514 TTGGATGCCACGCAAGTGGAGGG + Intronic
1130346377 15:83049834-83049856 TTGAATGCCCATCATATGCATGG - Intronic
1133590249 16:7235591-7235613 ATGGCTGCCCATCAATTGAAAGG - Intronic
1133695662 16:8260165-8260187 CTGGATGCCAAACAAGAGGAAGG + Intergenic
1136044093 16:27601931-27601953 TTGGATGGAAATCAGGTGGATGG + Intronic
1139456835 16:67086456-67086478 TGGGATTGCCATAAAGTGGAGGG - Intronic
1141736768 16:85859397-85859419 ATGCATGCCCAGGAAGTGGAAGG - Intergenic
1147335576 17:39725323-39725345 CCAGGTGCCCATCAAGTGGATGG + Exonic
1152519394 17:80846385-80846407 TTGGATGCCCGGCAGGTGGCAGG + Intronic
1161348384 19:3779015-3779037 CCGGCTGCCCGTCAAGTGGACGG - Exonic
1166018078 19:39998338-39998360 TTGGAGGCCCGTGAAGAGGAGGG - Exonic
925572273 2:5325180-5325202 TTTCATGACCATCCAGTGGAAGG - Intergenic
929417692 2:41760627-41760649 TTGAATGCCCATTATGTGCATGG - Intergenic
934161794 2:89256829-89256851 TAGGATGCCCATTTAGTTGATGG - Intergenic
934205488 2:89925533-89925555 TAGGATGCCCATTTAGTTGATGG + Intergenic
938695542 2:133832164-133832186 TTGGATGCCAATCATGTGCTAGG + Intergenic
939719143 2:145625626-145625648 TTGGATGCCTGTTAAGTGAAAGG + Intergenic
942950635 2:181717091-181717113 TGGGATGACCAGCAAGTGGGTGG + Intergenic
948116232 2:235495539-235495561 TTGGAGGCCACTGAAGTGGAGGG + Intronic
1168955221 20:1829843-1829865 TTGGCTTCCCACCAAGTGCATGG + Intergenic
1174430362 20:50464050-50464072 TTTGATGCCCAGAAAGTGCATGG - Intergenic
1175379316 20:58551920-58551942 TTGGATTCCCCTCCAGTGGAAGG - Intergenic
1180788495 22:18560142-18560164 AGGGATGGGCATCAAGTGGAAGG + Intergenic
1181233242 22:21435176-21435198 AGGGATGGGCATCAAGTGGAAGG - Intronic
1181245408 22:21499667-21499689 AGGGATGGGCATCAAGTGGAAGG + Intergenic
1184570132 22:45317784-45317806 TCGGCTGCCCACCAAGTGGCAGG + Intronic
1184621186 22:45679236-45679258 TTGGATGCTCATTATGTGGTAGG - Intronic
951540789 3:23780052-23780074 GTGGAGGCCTATCAAGTGGCTGG + Intergenic
954843268 3:53531912-53531934 TTGCATGCCCAGCAGGTGGCAGG + Intronic
958794654 3:98693973-98693995 AAGGATGTCCATCAAGTGAAAGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965781117 3:172287119-172287141 GTCCATGCCCATCAAGTGGGAGG + Intronic
969496777 4:7530764-7530786 TTGGCTGCCCAGCAAGAAGAGGG - Intronic
971359087 4:25920180-25920202 TTGGAAGTCCAGCCAGTGGAGGG + Intronic
973345059 4:49046613-49046635 TTGGCAGCACCTCAAGTGGAAGG + Intronic
974986941 4:69039562-69039584 TTGGATACCCATTAAATGTACGG - Intronic
978152988 4:105459022-105459044 TTGGATGCCTATTAAGTGCTAGG - Intronic
978844361 4:113254193-113254215 TTGGATGGCCATCAATGGAAAGG - Intronic
985986333 5:3519730-3519752 TTGGAGGCCAACCAAGTGCAGGG - Intergenic
987701053 5:21398757-21398779 TTGGATGCCCTGGAGGTGGAAGG - Intergenic
991366304 5:65871514-65871536 TTTTATGTCCATCAAGTGTATGG - Intronic
997436341 5:133878330-133878352 TCAGATGACCATCAAGTGGTGGG + Intergenic
997717756 5:136054723-136054745 TTGTATGGGCATCAATTGGAGGG - Exonic
999621622 5:153480257-153480279 TTGGATGTCCTTCAAGGGGTGGG - Intergenic
1001445662 5:171780740-171780762 TTGGAGGGCCCTCAAGTGGGAGG + Intergenic
1004007810 6:11652940-11652962 TCTGATGCCCATCAAGCAGATGG + Intergenic
1018014948 6:159703686-159703708 TTGGATGCTCATCAAATATAGGG - Intronic
1020931275 7:14398683-14398705 TTAGAAGCTCATCAAGGGGATGG + Intronic
1021174708 7:17437809-17437831 TTTGATGTCCATTAAGAGGAAGG - Intergenic
1023140231 7:37094563-37094585 GTGGATCCCCATCCAGTGGGTGG - Intronic
1023531870 7:41165639-41165661 TTTGACCCCCATCCAGTGGAAGG - Intergenic
1023867160 7:44243801-44243823 TTGGATCCCCATAACCTGGAAGG + Intronic
1030444083 7:109626790-109626812 TTGGAAGCCAGTCAAGGGGAAGG - Intergenic
1033883211 7:145913450-145913472 GTGGAAGCCAATTAAGTGGAAGG - Intergenic
1035715583 8:1751989-1752011 TTGGATGCCCCTTAAGTTCAGGG + Intergenic
1036519617 8:9478576-9478598 TTAGATTCATATCAAGTGGAAGG + Intergenic
1042459946 8:69053137-69053159 TTTGATGCTCATGAATTGGAAGG + Intergenic
1043018697 8:74972987-74973009 TGGGAGCCCAATCAAGTGGAAGG + Intergenic
1045655098 8:104378478-104378500 TTGAATACCCATCAATTGCATGG + Intronic
1045691917 8:104768048-104768070 TTGGAGGCCAAGGAAGTGGATGG + Intronic
1047290040 8:123521835-123521857 TTGGGTGCCCATCTATAGGAAGG + Intronic
1047334179 8:123920257-123920279 TTGCAAGACAATCAAGTGGATGG + Intronic
1052319852 9:27156136-27156158 TTGGAAGCCGAGCAAATGGATGG + Intronic
1052376394 9:27722684-27722706 CTGCATGCCCATAAAGTGAAAGG + Intergenic
1055566912 9:77578899-77578921 TTGGATGCCCATCAAGTGGAAGG - Intronic
1056374591 9:85994525-85994547 TTGGCTGCCCTTAAATTGGAAGG - Intronic
1058121889 9:101147981-101148003 TTGGATGCCCATTCACTTGAGGG + Intronic
1060477275 9:123996334-123996356 TTGGATGTACATCAAGAGGCTGG - Intergenic
1061344009 9:130007364-130007386 TTGGATGTGCAACAAATGGAAGG + Intronic
1187842818 X:23506424-23506446 TTGAGTGCCCATCAAGTGCCAGG - Intergenic
1188294558 X:28431778-28431800 TTGGATACCCATCCAGTAGTAGG - Intergenic
1193102877 X:77635914-77635936 TTGAAACCCCATCAAGTAGATGG - Exonic
1193990888 X:88305711-88305733 TTGGGGGCCCTTCAGGTGGATGG - Intergenic
1194931746 X:99896665-99896687 TTTGGCACCCATCAAGTGGAAGG + Intergenic
1195083239 X:101390496-101390518 TTGGATGCCCATTATGTGGCAGG - Intronic
1195178302 X:102332217-102332239 TTGGAAGCCCATCATCTGAAAGG - Intergenic
1195180562 X:102354874-102354896 TTGGAAGCCCATCATCTGAAAGG + Intergenic
1200963297 Y:9014329-9014351 TTGGCTGCCCTTCATGTTGAGGG - Intergenic