ID: 1055573113

View in Genome Browser
Species Human (GRCh38)
Location 9:77636730-77636752
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055573105_1055573113 19 Left 1055573105 9:77636688-77636710 CCAGCTCTCTCAAGAATACAGTG 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1055573113 9:77636730-77636752 GGGCACTAATCTATTCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr