ID: 1055574565

View in Genome Browser
Species Human (GRCh38)
Location 9:77648243-77648265
Sequence TTGGAGGCAAAGGACCTGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055574552_1055574565 17 Left 1055574552 9:77648203-77648225 CCTAGGGGTGTCCCCAGGCGGGA 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1055574565 9:77648243-77648265 TTGGAGGCAAAGGACCTGGCTGG 0: 1
1: 0
2: 2
3: 21
4: 224
1055574557_1055574565 5 Left 1055574557 9:77648215-77648237 CCCAGGCGGGAGGTAGGCGCGGA 0: 1
1: 0
2: 0
3: 11
4: 92
Right 1055574565 9:77648243-77648265 TTGGAGGCAAAGGACCTGGCTGG 0: 1
1: 0
2: 2
3: 21
4: 224
1055574548_1055574565 23 Left 1055574548 9:77648197-77648219 CCTGGGCCTAGGGGTGTCCCCAG 0: 1
1: 0
2: 2
3: 29
4: 262
Right 1055574565 9:77648243-77648265 TTGGAGGCAAAGGACCTGGCTGG 0: 1
1: 0
2: 2
3: 21
4: 224
1055574555_1055574565 6 Left 1055574555 9:77648214-77648236 CCCCAGGCGGGAGGTAGGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1055574565 9:77648243-77648265 TTGGAGGCAAAGGACCTGGCTGG 0: 1
1: 0
2: 2
3: 21
4: 224
1055574558_1055574565 4 Left 1055574558 9:77648216-77648238 CCAGGCGGGAGGTAGGCGCGGAG 0: 1
1: 0
2: 3
3: 18
4: 183
Right 1055574565 9:77648243-77648265 TTGGAGGCAAAGGACCTGGCTGG 0: 1
1: 0
2: 2
3: 21
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055574565 Original CRISPR TTGGAGGCAAAGGACCTGGC TGG Exonic
900111112 1:1006007-1006029 TTAGACCTAAAGGACCTGGCAGG - Intergenic
900220677 1:1508002-1508024 TGGGAAGCACGGGACCTGGCAGG - Intergenic
900312378 1:2040122-2040144 TTGGGGGCAAGGGGCCTGGTCGG + Intergenic
901083883 1:6599083-6599105 TTGGGGGCGAAGGACCAGGGCGG + Exonic
901481525 1:9528511-9528533 TGGGAGGCCAAGGACCAGCCTGG + Intergenic
905247777 1:36626879-36626901 AGAGAGGCATAGGACCTGGCTGG + Intergenic
905282986 1:36860764-36860786 ATGGCGGCAGAGGACGTGGCAGG + Intronic
906523305 1:46479681-46479703 TTGGAGGCTGAGGAACTAGCAGG + Intergenic
915523160 1:156460087-156460109 TTGGAGGCAAGTGGCCTGTCAGG - Intergenic
916744422 1:167673792-167673814 TTGTAGGCACAGGGGCTGGCTGG - Intronic
918051080 1:180972919-180972941 TTAGAAGCAAAGGCCCTGGGAGG + Exonic
919562386 1:199137910-199137932 TGGGAGGCCAAGTAGCTGGCAGG + Intergenic
919784517 1:201250809-201250831 TAGGAGGCACAGGAGCCGGCTGG + Intergenic
919919321 1:202159003-202159025 TCGGAGCCACAGGGCCTGGCTGG - Intronic
920679653 1:208062768-208062790 TTGGAGAGGAAGGAGCTGGCAGG + Intronic
920825548 1:209421466-209421488 TTGGGTGCTGAGGACCTGGCTGG - Intergenic
922790520 1:228308475-228308497 TTGGAGGCTGGGGGCCTGGCAGG + Intronic
923046498 1:230359910-230359932 TTGGAGGAAGAGGCCCTGGCTGG + Intronic
923681735 1:236124057-236124079 TTGGAGGCCAAGGCGTTGGCAGG - Intergenic
1062778192 10:173735-173757 TTAAGGGCAAAAGACCTGGCTGG + Intronic
1063352189 10:5365818-5365840 TTGGTGGCAGAGGACCTGGCTGG - Intronic
1064911539 10:20406964-20406986 TTGGAGGCCGAAGACTTGGCAGG + Intergenic
1066101343 10:32121396-32121418 GTGTAGGCAAAGGACCGGGGTGG + Intergenic
1067806572 10:49397192-49397214 TTGGAAACAAAAGGCCTGGCAGG + Intergenic
1069780036 10:70949620-70949642 TTGGAGGAGAGGGACCTGGGAGG + Intergenic
1069805918 10:71125043-71125065 GTGGAGGCAATGCAGCTGGCAGG + Intergenic
1070630766 10:78082801-78082823 TTGGAGGCAGGGGGACTGGCTGG - Intergenic
1071181164 10:82985186-82985208 TTGGAGCAAAAGGACCTGGTGGG + Exonic
1073248506 10:102107796-102107818 ATGGAGGCAAATGCCCTGGGGGG + Exonic
1074068775 10:110045056-110045078 TTTGAAGTAAAGTACCTGGCTGG + Intronic
1076843462 10:133057774-133057796 GTGCAGGTAAGGGACCTGGCAGG + Intergenic
1077820975 11:5740257-5740279 GTGGAGGGAAATGCCCTGGCTGG + Intronic
1083654644 11:64223629-64223651 GTGCAGGCCAAGGACCTGGCAGG + Exonic
1083729879 11:64647094-64647116 ATGGAGGCAAAGGCACTGACTGG + Intronic
1083745687 11:64735412-64735434 TAGGAGTCACAGGGCCTGGCAGG - Intronic
1084126087 11:67099941-67099963 TTGGAGGCAGAGGAGGCGGCAGG + Intergenic
1090875083 11:130781691-130781713 TTGGGGACACAGCACCTGGCAGG + Intergenic
1091673289 12:2467880-2467902 ACCGAGGCAAAGCACCTGGCAGG - Intronic
1091952800 12:4608869-4608891 CGGTAGGCAAAGGATCTGGCTGG + Intronic
1092597967 12:10028151-10028173 TTGGAGGCAGAGGAAAAGGCAGG - Intergenic
1098026278 12:66205838-66205860 TTGTAGGCATAGTACCTGGGAGG - Intronic
1098050542 12:66447975-66447997 AGGGAGGCAAAGCAACTGGCTGG - Intronic
1098352260 12:69575495-69575517 CTGAAGGCAAAGGAGCTGACTGG - Exonic
1101124927 12:101623052-101623074 GAGGAGGCACAGCACCTGGCCGG - Intronic
1102538595 12:113601326-113601348 TAGGAGGCAAAAGATCAGGCTGG - Intergenic
1103906840 12:124332163-124332185 TGTGAGGCAAAGGGCCTGGGGGG + Intronic
1104967566 12:132515352-132515374 GTGGAAGCTAAGGACCTGCCTGG - Intronic
1105305512 13:19166071-19166093 TAGGAAGCAAAGGGCATGGCTGG + Intergenic
1107753244 13:43591883-43591905 TTGAAGGCAAAAGACCAGCCTGG + Intronic
1112212173 13:97388624-97388646 TAGGAGGCACAGGACCTTACAGG - Intronic
1112468807 13:99669296-99669318 TTCAAAGCTAAGGACCTGGCCGG - Intronic
1114375726 14:22144475-22144497 TTGGACACTAAGGACCTGGAAGG + Intergenic
1115776538 14:36721399-36721421 TTGGAAGCACAAGACCTGGAGGG - Intronic
1115889182 14:38008070-38008092 TTGGAGGCATAGGACTGGGAAGG - Intronic
1116620250 14:47192539-47192561 TGGGAGGCAGAGAACCTGGGAGG + Intronic
1118113000 14:62743695-62743717 ATGGTGGTAAAGGACCTTGCTGG - Intronic
1120186992 14:81403665-81403687 TAGGAGCCATAGGACCTAGCCGG - Intronic
1122465026 14:101926835-101926857 TTGGAGGAAAATCACCTGGGGGG + Exonic
1124002133 15:25768401-25768423 TGAGAGGCAAAGCTCCTGGCTGG + Intronic
1126376674 15:48003749-48003771 TTGAAGCCAAAAGACCTGGTGGG - Intergenic
1127884893 15:63189966-63189988 TTGGGGGCAAAGGAACGGGAAGG + Intronic
1127971609 15:63966456-63966478 TTGGAGCCAGAGGACTTGGAGGG - Intronic
1128302384 15:66574657-66574679 CTGGAAGCAGAGGACTTGGCTGG - Intergenic
1129159061 15:73737058-73737080 TTGGGGGCAAATGGCCAGGCAGG + Exonic
1129463972 15:75713446-75713468 TTTGAGGCAAATGTCATGGCGGG - Intergenic
1129970422 15:79773493-79773515 TTGGGGGAAAAGAACATGGCGGG - Intergenic
1131801772 15:96076648-96076670 GAGGAGGCAAAGGACCTCACAGG + Intergenic
1134084682 16:11348350-11348372 TTGCAGGCAAAGCACCTTGCAGG + Intronic
1134636096 16:15793164-15793186 TTAGAGGCCATGGGCCTGGCTGG - Intronic
1136228139 16:28872485-28872507 TAGGAGGCAAAGGCCCTGCCAGG - Intronic
1138137927 16:54539667-54539689 CTGGAGGCAAGACACCTGGCTGG - Intergenic
1138448522 16:57079222-57079244 TTGGCGGAAAACAACCTGGCTGG + Exonic
1141000800 16:80306116-80306138 TTGCAGGCAAAGTGCCTGCCTGG + Intergenic
1142849042 17:2695552-2695574 GTGGAGGCAGAGGAGCTGGGTGG - Intronic
1143124972 17:4636156-4636178 CTGGAGGCAAAGCAGCTTGCAGG - Intronic
1143403542 17:6661001-6661023 CTGGAGGCAAAGCAGCTTGCAGG + Intergenic
1144701462 17:17343615-17343637 TGGGAGGGCAAGGACCTGCCCGG + Intronic
1145280881 17:21466165-21466187 TTGGAAGGGAAGGTCCTGGCTGG - Intergenic
1145394994 17:22487712-22487734 TTGGAAGCAAGGGACCTCTCAGG + Intergenic
1146623646 17:34419553-34419575 TGGGAGGCAAAGCACTGGGCGGG + Intergenic
1147268431 17:39248993-39249015 TTGGAGGGTGAGGACCTGACTGG + Intergenic
1148995576 17:51706549-51706571 TAGGGGGCAAAGGCCCCGGCAGG - Intronic
1149720942 17:58843193-58843215 TGGGAGGCAGAGAACCTGGGAGG + Intronic
1150876061 17:68971640-68971662 TTGGTGGAAAAGGACCTCGAAGG - Intergenic
1152196337 17:78920552-78920574 TTGGAGGGACAGGATCTGTCAGG - Intronic
1156480296 18:37432130-37432152 CTGGAGGCTAAGGACCCAGCAGG - Intronic
1156646056 18:39163304-39163326 TTGGTGGCAAAGGTCAGGGCAGG + Intergenic
1157402332 18:47398905-47398927 TTGCAGGCATGGGACATGGCAGG + Intergenic
1157486470 18:48090802-48090824 TTGGAGGCAGTGGAACTGGAAGG - Intronic
1158231159 18:55256965-55256987 TTCCAGGTATAGGACCTGGCTGG + Intronic
1158549930 18:58427030-58427052 TGGGAGAGAAAGGACCTGACTGG + Intergenic
1159618433 18:70609175-70609197 TTGGAGGCAAGGAACGTGGCAGG + Intergenic
1159917755 18:74201466-74201488 TTGGGGGCAAATGACCAGGAAGG - Intergenic
1161103396 19:2432331-2432353 CTGGAGGCACAGGACTTGGCGGG - Intronic
1161428124 19:4215802-4215824 TGGGTGGCAAAGGACATGGAAGG + Intronic
1161458099 19:4380050-4380072 TTGGAGGGGAAGGACACGGCAGG + Intronic
1162096398 19:8312306-8312328 GTGGAGGCACAGGACCTCCCAGG + Intronic
1162773573 19:12965330-12965352 TTGGAGCCTTAGCACCTGGCAGG + Intronic
1163495821 19:17646072-17646094 TTGCAGGCAAAGGACAAGACAGG - Exonic
1164521469 19:28983230-28983252 ATGGAGGTAAAGCACCTGCCGGG + Intergenic
1166914914 19:46188785-46188807 TGGGAGGCAAATGAGCTGTCAGG - Intergenic
1166937071 19:46340327-46340349 TTGGAAGCAGAGGAACTGGGAGG - Exonic
1168094656 19:54107811-54107833 TTGGAGGCCTAGGATCAGGCAGG - Intronic
1168450889 19:56465821-56465843 CTGGCGTCTAAGGACCTGGCTGG + Intronic
926627884 2:15108594-15108616 AGGGAGGCAAGGCACCTGGCTGG + Intergenic
928358998 2:30648003-30648025 TTGGTGGCAGAAGAGCTGGCCGG - Intergenic
930019752 2:46994357-46994379 ATGGCGGCCAAGCACCTGGCGGG + Exonic
930086353 2:47500217-47500239 CAGGAGGCAAAGGATCTGCCTGG - Intronic
930931977 2:56896286-56896308 TTGGAGGTAAGTGACCTGTCTGG + Intergenic
933685729 2:85139949-85139971 TTGGAGGACGAGGACCTGGAAGG + Intronic
938583704 2:132669806-132669828 TTGGGGGCAAAAGGGCTGGCGGG + Intronic
941231540 2:162916833-162916855 TTGGGGGCAAGGGTCCTGCCTGG - Intergenic
942950222 2:181713053-181713075 TGGGAGGGGAAGGACCTGGTGGG + Intergenic
944880415 2:204007434-204007456 TTGGAGGCAAAGGGTCTGAGAGG + Intergenic
945929294 2:215839394-215839416 TTGGAGGAGCAGGACCTGCCAGG + Intergenic
947696712 2:232196515-232196537 CTGGAGGCAAAGGAACTGCCTGG - Intronic
1170777513 20:19390649-19390671 TTGGAGTCACAGGGACTGGCTGG + Intronic
1171982413 20:31637558-31637580 TAGGAGGCATTGGGCCTGGCTGG + Intergenic
1172390163 20:34560336-34560358 CTGGAGGCACAGGGCCAGGCAGG - Exonic
1172759929 20:37314714-37314736 TTGGGGGCCTGGGACCTGGCTGG + Intronic
1172804865 20:37604556-37604578 TTGGAGGGAAATGACCATGCAGG + Intergenic
1173839892 20:46150513-46150535 CTGGAGGCAAAGGACCTAGTTGG - Intergenic
1173907347 20:46638619-46638641 CTGGAGGCAGAGGGCCTGGCAGG - Intronic
1174340090 20:49890079-49890101 TTGGGGGCAAAGGGGGTGGCGGG + Exonic
1176085011 20:63291944-63291966 CTGGAGGCAAAGGCCCAGGCTGG - Intergenic
1177544353 21:22536605-22536627 TTGGAGTCAAAGGAACTCACTGG + Intergenic
1178297494 21:31422667-31422689 GTGGAGGCACAGGACATTGCTGG - Intronic
1178604121 21:34020442-34020464 GTGGAGGCAGAGGCACTGGCTGG - Intergenic
1179289291 21:40004903-40004925 TTGGAGAAAGAGGACCTTGCTGG + Intergenic
1181061421 22:20283818-20283840 CTGGAGGCAAGGGGCTTGGCAGG + Intergenic
1181308206 22:21928856-21928878 GAGGAGGGCAAGGACCTGGCAGG - Intronic
1181620068 22:24084998-24085020 TGGGAGGCAGGGTACCTGGCAGG - Exonic
1181802737 22:25358112-25358134 TGGGAGGCAGAGGGGCTGGCCGG - Intronic
1184110200 22:42389736-42389758 CAGGAGGCAAAGGGCCTGGGGGG - Intronic
1184165406 22:42724326-42724348 TAGGAGGAAAGGGACCTGCCAGG - Intergenic
1184530828 22:45054395-45054417 CTGGAGGGAAAGGAGCTGCCTGG + Intergenic
1184609473 22:45593590-45593612 TAGGAGGCAAACACCCTGGCAGG + Intronic
949934222 3:9104570-9104592 TTGGAGACAAGGGACCAGGAGGG - Intronic
950218739 3:11178479-11178501 TTGGAGGCAAAGGTACAGCCAGG - Intronic
950889014 3:16386782-16386804 CAGGAGGCAAGGGACATGGCTGG + Intronic
952946071 3:38478537-38478559 GTGGAGGCAGAGGACCTGGATGG - Intronic
954443450 3:50534194-50534216 CAGGAGGCACAGGACCAGGCAGG - Intergenic
954902951 3:54035514-54035536 TTTGAGGCAAAGGACCTCAGAGG + Intergenic
955987363 3:64587929-64587951 GTGGAGGCCAAGGACCCAGCAGG + Intronic
958942661 3:100332768-100332790 TTAGAGGAGAAGGACCAGGCCGG - Intergenic
959682753 3:109114858-109114880 GTGCAGGCAAAGGAACTGGCAGG + Intronic
960743860 3:120864808-120864830 TTTGGGACAAAGGAGCTGGCCGG - Intergenic
962212630 3:133491700-133491722 CTGGAGCCAAAGGGCCAGGCAGG - Intergenic
964132537 3:153306018-153306040 CTGGAGGCAAAAGAACTGGTAGG + Intergenic
965960310 3:174421724-174421746 TTGGAGGGAAAGAAAATGGCAGG - Intergenic
966714996 3:183005954-183005976 TTGAAAGCAAAGGACCTGCCGGG + Intergenic
968450714 4:674796-674818 TTGTAGGAGAAGGACCTGCCCGG - Intronic
968671038 4:1851759-1851781 CTTGAGGCACAGGAGCTGGCCGG - Intronic
968741527 4:2333973-2333995 TTGGAGGGAAGTGTCCTGGCGGG - Intronic
969516339 4:7650281-7650303 TGAGAGGCAAAGGGCCCGGCTGG + Intronic
969572048 4:8014845-8014867 AGGGAGGCAAAGGCGCTGGCTGG - Intronic
970415616 4:15854026-15854048 CTTGATGCAAAAGACCTGGCAGG + Intergenic
970506543 4:16736075-16736097 TAGGAGGAAAAGCACCAGGCGGG - Intronic
970765331 4:19541660-19541682 TTAAAGGCAAAGGACCAGGACGG - Intergenic
972576489 4:40356716-40356738 TGTGAGCCAAAGCACCTGGCCGG + Intergenic
975710943 4:77158542-77158564 TTGGGGGCAGAGCACTTGGCAGG + Exonic
977053583 4:92161708-92161730 TTGCAGGCAGAGGGACTGGCAGG + Intergenic
977601640 4:98939572-98939594 TTGGAGGCACATGACCTGGGTGG + Intergenic
978103917 4:104877879-104877901 AGGCAGGCAAAGGACATGGCTGG - Intergenic
979418060 4:120467827-120467849 TTGGATGCAAAGGAACTGTAGGG + Intergenic
982344745 4:154344974-154344996 TTGGTGCCAAAGGACTTGGGAGG + Intronic
984624714 4:181993668-181993690 TTTGAGGCATAGGACATGGTTGG - Intergenic
985629567 5:1007666-1007688 TTGGAGTGAAAGGGCTTGGCTGG + Intergenic
985865210 5:2509200-2509222 TTGGAATCACAGGACCAGGCTGG - Intergenic
985897691 5:2758817-2758839 CTGGAGGCAAAGGACAAGCCTGG + Intergenic
986284567 5:6349731-6349753 TTGAGGTCAAAGGACCGGGCAGG - Intergenic
988203309 5:28098511-28098533 TTGGAGGAAAAAGACCTGTGGGG - Intergenic
991067120 5:62435633-62435655 TGGGTGGCCAAGGACCTGGCAGG + Intronic
991342366 5:65625216-65625238 TTGGCGGCAAAGGACAGAGCAGG - Intronic
991970551 5:72136687-72136709 TTGGAGGGAAAGGGAGTGGCTGG - Intronic
996193116 5:120569805-120569827 TTGAAAACAAGGGACCTGGCTGG + Intronic
998228573 5:140345180-140345202 TTGGAGGCAGGAGAGCTGGCAGG + Intronic
998500627 5:142629493-142629515 TTGGAGGCAAATGCTCTGCCTGG - Intronic
999062631 5:148652993-148653015 TTGAAGGAAAAGGACGTGGGTGG - Intronic
1000073837 5:157766162-157766184 TAGGAGGCAAAGCTCCTGGCAGG - Intergenic
1000646453 5:163766024-163766046 GTGGAGGCAAAGGTGCTGGAGGG - Intergenic
1001204739 5:169751965-169751987 TTGGAGGCAGATGACCTGGATGG - Intronic
1002688280 5:181032472-181032494 GTGGAGGGAGAGGCCCTGGCGGG + Intergenic
1003987405 6:11450990-11451012 TTGGAGGCAAGAGTGCTGGCAGG - Intergenic
1004593973 6:17081144-17081166 TTGGCGGCAGAGGAGATGGCTGG + Intergenic
1006188417 6:32192966-32192988 AGGGAGGGAAGGGACCTGGCTGG - Intronic
1006719844 6:36142979-36143001 TGGGGGGCAGAGGAGCTGGCGGG + Intronic
1006830366 6:36964515-36964537 CTGGAGGCACAAGGCCTGGCTGG + Exonic
1010136676 6:72562207-72562229 AAACAGGCAAAGGACCTGGCAGG - Intergenic
1011916861 6:92516933-92516955 TTGGAGGCAGAGGAGTTGTCTGG + Intergenic
1013351082 6:109306294-109306316 TTGGAGACAAAGACCCTGACTGG - Intergenic
1017095285 6:150799445-150799467 TCTGAGGACAAGGACCTGGCTGG - Intronic
1018736079 6:166688145-166688167 TGGAAGGCGAAGGAGCTGGCAGG + Intronic
1018994220 6:168699002-168699024 TTGGAGGCACAGGACCTGAAGGG + Intergenic
1020386121 7:7604263-7604285 TTGCAGGCAAAGCACCAGGGAGG - Intronic
1020910525 7:14124892-14124914 TTGTAGCCCAAGGATCTGGCTGG + Intergenic
1021133841 7:16942984-16943006 GTGGAGGGAGAGGAGCTGGCGGG + Intergenic
1021279652 7:18702082-18702104 TTGGAAGCAAAGAAGCAGGCTGG + Intronic
1022725419 7:32976897-32976919 TTGGTGGCCAAGGCCATGGCAGG - Intronic
1024937151 7:54721854-54721876 TCTGAGGAAGAGGACCTGGCTGG + Intergenic
1025048194 7:55710919-55710941 TTGGTGGCCAAGGCCATGGCAGG + Intergenic
1026354446 7:69545124-69545146 TTGGAGGGAAAGAGCCTTGCAGG + Intergenic
1026552362 7:71379472-71379494 TTGGAGGCAAGGGACCAGTTAGG + Intronic
1027155793 7:75766783-75766805 TGGGAGGCAGAGGTCCTGGGAGG + Intergenic
1030039741 7:105439068-105439090 ATGGAGGAAAAGGACCGGGTAGG - Intergenic
1030809227 7:113955268-113955290 GTGGAGGCAAGGCAGCTGGCGGG + Intronic
1032335531 7:131021365-131021387 TTGGAGGCCAAGGACCAGGCAGG + Intergenic
1033679997 7:143584408-143584430 TTGGTGGCATAGGAACTGGAGGG - Intergenic
1033691837 7:143745035-143745057 TTGGTGGCATAGGAACTGGAGGG + Intergenic
1033755472 7:144395620-144395642 TTGGAGGAAAGGGACCTGAGAGG - Intergenic
1034581874 7:152050650-152050672 TTGGAGCCAATGGACTTGGAGGG - Intronic
1034979835 7:155468453-155468475 TTCCAGACAAAGGACTTGGCGGG - Intergenic
1036744820 8:11399175-11399197 TTGGAGGGAAAAGGTCTGGCAGG + Intronic
1036809042 8:11854584-11854606 TGGGAGGCTAAGAACCTGGGAGG - Intronic
1036838505 8:12095275-12095297 TTCGAGGCAAAAGTCCTGACAGG + Intergenic
1036860294 8:12341523-12341545 TTCGAGGCAAAAGTCCTGACAGG + Intergenic
1037298788 8:17430091-17430113 TTGGAACCAAAGGACAGGGCAGG - Intergenic
1041886684 8:62817047-62817069 AGGGAAGCAAAGCACCTGGCTGG - Intronic
1043863051 8:85343556-85343578 TAGGAGGCAAATTACCTGGCAGG - Intronic
1044696318 8:94925466-94925488 TTGGAGGGAAAGGTACTGGTTGG + Intronic
1045691917 8:104768048-104768070 TTGGAGGCCAAGGAAGTGGATGG + Intronic
1048579948 8:135722594-135722616 GTGGGGGCAAAGGCCCTGGAGGG + Intergenic
1049020827 8:139956758-139956780 TAGGAGGCATAGGACCTGCCCGG - Intronic
1049536608 8:143185565-143185587 GTGGAGGAAAAGGGCCTGGAGGG - Intergenic
1049663398 8:143830633-143830655 TTCGAGGCCAGGGATCTGGCTGG - Intergenic
1049743689 8:144253610-144253632 TGGGGAGCAAATGACCTGGCAGG - Intronic
1050477321 9:6053555-6053577 CTGGAGGCAAGGGATCTGGGTGG + Intergenic
1050737903 9:8785536-8785558 ATGGAGGCAGAGGGGCTGGCAGG - Intronic
1051535420 9:18152182-18152204 CTGGAGTCACAGGACCTGGGTGG - Intergenic
1053358222 9:37465036-37465058 TTGGAGCCAAGGGGCCAGGCGGG - Intronic
1055574565 9:77648243-77648265 TTGGAGGCAAAGGACCTGGCTGG + Exonic
1056666790 9:88587792-88587814 TTGGAGGGAAATGAACTTGCAGG - Intergenic
1056969639 9:91191637-91191659 TTGAAGGCACAGAACCTTGCTGG + Intergenic
1057164841 9:92917365-92917387 TTGGAGGCAGAGCAGCTTGCAGG + Intergenic
1057422122 9:94920924-94920946 GTGGAGGAAAAGGAGGTGGCAGG - Intronic
1058420026 9:104824639-104824661 AAGGAGGAAATGGACCTGGCTGG - Intronic
1058593277 9:106587877-106587899 TTGTAGTCTAAGGCCCTGGCAGG + Intergenic
1058851093 9:109013028-109013050 CTGGGGGCAAAGGCCCAGGCCGG + Intronic
1058937586 9:109783189-109783211 ATGGAGGTGAAGCACCTGGCAGG + Intronic
1060783536 9:126431423-126431445 TTGGAGGAAAAGTGCCTGGGGGG + Intronic
1062555708 9:137112634-137112656 CAGGAGGCAAAGCCCCTGGCCGG + Intronic
1185666834 X:1772265-1772287 TTGGAGGTAGAGGAGCTGGTGGG + Intergenic
1188682595 X:33029447-33029469 GTGGAGGCAAAGGAACAGACAGG - Intronic
1193896971 X:87126842-87126864 TAGGAGCCTCAGGACCTGGCAGG - Intergenic
1194331236 X:92585242-92585264 TTGGAGGCAGGGGGCCTGGTGGG - Intronic
1199505080 X:148552423-148552445 TTGGAACCCAAGGACCTGACTGG + Intronic
1199849101 X:151712552-151712574 TTGGAGGCAGATGATCAGGCTGG + Intergenic
1200639937 Y:5704299-5704321 TTGGAGGCAGGGGGCCTGGTGGG - Intronic