ID: 1055574895

View in Genome Browser
Species Human (GRCh38)
Location 9:77650883-77650905
Sequence CTGGTAAGAAACAGAAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055574891_1055574895 4 Left 1055574891 9:77650856-77650878 CCTAAAGTTGTTATTGAGCATCA No data
Right 1055574895 9:77650883-77650905 CTGGTAAGAAACAGAAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055574895 Original CRISPR CTGGTAAGAAACAGAAAACT GGG Intergenic
No off target data available for this crispr