ID: 1055586877

View in Genome Browser
Species Human (GRCh38)
Location 9:77764112-77764134
Sequence TAGGAGTATAGGTTTGTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055586877_1055586881 13 Left 1055586877 9:77764112-77764134 CCAAATACAAACCTATACTCCTA 0: 1
1: 0
2: 0
3: 14
4: 196
Right 1055586881 9:77764148-77764170 GATTGAGTCAGGTGAATTTCAGG No data
1055586877_1055586880 2 Left 1055586877 9:77764112-77764134 CCAAATACAAACCTATACTCCTA 0: 1
1: 0
2: 0
3: 14
4: 196
Right 1055586880 9:77764137-77764159 CAAGAAAGTGAGATTGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055586877 Original CRISPR TAGGAGTATAGGTTTGTATT TGG (reversed) Intronic
901277854 1:8006706-8006728 GAGGAGTATTGGGTTTTATTCGG - Intronic
902603692 1:17556739-17556761 TAGTATTATAGGTTGGTATCAGG + Intronic
906193117 1:43911447-43911469 TAGAAGGACAGGTTTGAATTTGG - Intronic
906591865 1:47032280-47032302 AAAGAATATAGGCTTGTATTAGG + Intronic
907146268 1:52234690-52234712 TAGGAATATAGGTTAGTGTTAGG - Intronic
908445894 1:64199553-64199575 TAGTAATATAGGTTTGTTGTGGG + Intergenic
911000257 1:93157579-93157601 TAGGACTACAGGTGTGTACTCGG - Intronic
913380572 1:118205924-118205946 TAACAGTATAGGTGTGTAGTAGG + Intergenic
913416351 1:118612985-118613007 TAGGTGTATAGATTTGTTTCTGG + Intergenic
913503030 1:119489250-119489272 TAAGAGTATATATTGGTATTAGG + Intergenic
917986166 1:180321100-180321122 TAGGTGTATAGATTTGTTTCTGG + Intronic
919127133 1:193408728-193408750 TAGGAACATTAGTTTGTATTTGG + Intergenic
919477753 1:198050311-198050333 TAGGAGTATGGATTTGTTTCTGG + Intergenic
919667366 1:200304912-200304934 TAGTAGAATAGGTTTGGACTGGG - Intergenic
920566628 1:206979338-206979360 TAGAAGTATTGGTAGGTATTAGG + Intergenic
921014284 1:211173661-211173683 TGGGGTTATAAGTTTGTATTTGG - Intergenic
921408510 1:214809061-214809083 AAGGAGAAAAGGTTTGCATTAGG - Intergenic
921573975 1:216812541-216812563 TAAGAATATAGGTTTGTTTTTGG + Intronic
923404072 1:233643228-233643250 TAGGAGTAGAGGACTGGATTTGG + Intronic
924242256 1:242052614-242052636 TAGGTGTATGGGTTTGTTTCTGG - Intergenic
1062762294 10:33387-33409 TAGGAGTAAAGTTGTTTATTCGG - Intergenic
1062895414 10:1099351-1099373 TAGAAGTTTCAGTTTGTATTGGG + Intronic
1063946191 10:11178561-11178583 TAGGAGTATAGTTTTTTAAGTGG + Intronic
1064190382 10:13200819-13200841 TAGGAGTGTTTATTTGTATTTGG + Intronic
1069248819 10:66243954-66243976 CAAGAGTGTAGGCTTGTATTGGG - Intronic
1069357120 10:67598924-67598946 TATGAGTATTGGTTTCTATTGGG - Intronic
1073601015 10:104846093-104846115 TATGAGTATATTTTTGTGTTAGG + Intronic
1074069410 10:110050935-110050957 TTGGAGTATAAGTTGGTGTTTGG + Intronic
1078299780 11:10116577-10116599 TAGGAGTTTATATTTGAATTAGG - Intronic
1078475958 11:11630368-11630390 GAAGAGTATAGGTTGGTAGTGGG - Intergenic
1080295866 11:30726735-30726757 CAGGTGTGTAGGTTTGTTTTGGG - Intergenic
1081095669 11:38931164-38931186 TATGAGTATATGTGTGTCTTTGG + Intergenic
1081371440 11:42309357-42309379 TGGGACTATAGATTTGGATTTGG - Intergenic
1084841778 11:71857598-71857620 TAGGAGTGCAGGTATGTTTTGGG + Intergenic
1085848155 11:80089595-80089617 TAAGAATGTATGTTTGTATTTGG - Intergenic
1086073617 11:82826086-82826108 AATGAGTATGGGTTTCTATTTGG - Intronic
1086199802 11:84188199-84188221 TAGGTGTATATGTTTATATAGGG + Intronic
1087308210 11:96508309-96508331 AAGGAGTATATGTGTGTGTTTGG + Intergenic
1088046881 11:105463628-105463650 TAGGTGTATGGTTTTGTATCTGG - Intergenic
1088367924 11:109058433-109058455 TAGGAGCATAGGCTTTTATAAGG + Intergenic
1088681000 11:112241632-112241654 TTGGAGAATAGATTTGTCTTAGG + Intronic
1090212826 11:124935027-124935049 TAGGAGTATAAGTGGGTGTTAGG - Intronic
1093134590 12:15435792-15435814 GAGGAGTATGTGTTAGTATTTGG - Intronic
1094770827 12:33657144-33657166 TAGGAATATAAATTTGAATTTGG - Intergenic
1096422132 12:51468003-51468025 TAGGAGTCAAAGTTTGCATTTGG + Intronic
1097596200 12:61634646-61634668 TGGGAGAATATCTTTGTATTTGG - Intergenic
1098435706 12:70466417-70466439 TAGGAGTATATATTGGTTTTAGG - Intergenic
1102602935 12:114046506-114046528 TTGGGGTATGGGTTTGGATTAGG + Intergenic
1103522252 12:121544139-121544161 TAGGACTATAGGTGTGTACCTGG - Intronic
1105391780 13:19986261-19986283 TAGGACTATAGGTGTGTGCTAGG - Intronic
1107046900 13:36002571-36002593 TTGAAGTATAGTTTTATATTGGG + Intronic
1109925218 13:69128000-69128022 TATGAGTGTAGGTGTGTTTTTGG + Intergenic
1110039255 13:70731424-70731446 TAGAATTCTAGTTTTGTATTAGG + Intergenic
1112833620 13:103485280-103485302 TAGGAGCATAGCTTTGATTTGGG + Intergenic
1114588526 14:23837507-23837529 TAGGAGAATTGGTTGGTATCAGG - Intergenic
1116230741 14:42213151-42213173 GAAGAGTATAGCTTTATATTTGG + Intergenic
1118775440 14:68971068-68971090 AAGGAGTTTATGTTTGAATTGGG - Intronic
1123055911 14:105570283-105570305 TAGGTGTATGGGTTTGTGTGTGG - Intergenic
1125254696 15:37750089-37750111 TAGGTGTATGGGTTTGTTTCTGG - Intergenic
1127491120 15:59464973-59464995 TTGGAGTTTATTTTTGTATTGGG + Intronic
1128024655 15:64425244-64425266 TAGTAGAATCGATTTGTATTAGG + Intronic
1131722921 15:95190175-95190197 TAGGAGTATATGTGTCTTTTTGG - Intergenic
1134754869 16:16658077-16658099 TAGGACTATAGGTGTGCACTAGG + Intergenic
1134991192 16:18701056-18701078 TAGGACTATAGGTGTGCACTAGG - Intergenic
1140249859 16:73286642-73286664 TGGGTGTATAGGTTTGTGTGTGG + Intergenic
1142439241 16:90084283-90084305 TAGGAGTATGGGTTTATTTCTGG - Intronic
1144221519 17:13104277-13104299 TAGGAGTATAAGTTTTTGTCTGG + Intergenic
1146514269 17:33476963-33476985 TAGTAGTATAGGCTTGTTCTTGG - Intronic
1147370813 17:39991569-39991591 TAGGAGCAGAGGTTTGAATTTGG - Intronic
1148135890 17:45291510-45291532 TAGAGGTATAGGTTCGTGTTAGG - Intronic
1148922061 17:51046314-51046336 TAGGATTATAGCTTTATGTTTGG - Intronic
1148952534 17:51326193-51326215 TTGATGTATAGTTTTGTATTAGG - Intergenic
1149025387 17:52021269-52021291 TCTGAGTATAGGTTTCTTTTTGG + Intronic
1149814484 17:59709742-59709764 AATGAGTATAGTTTTGCATTCGG + Intronic
1149945591 17:60921712-60921734 GAGGAGTATGGGTTCCTATTGGG + Intronic
1151080097 17:71319584-71319606 TCAGAGTATAGGTTTTTATATGG + Intergenic
1151935967 17:77261474-77261496 GAGGTGTGTAGGTTTGTCTTGGG + Intergenic
1152955204 18:33717-33739 TAGGAGTAAAGTTGTTTATTCGG - Intergenic
1156535189 18:37856307-37856329 TAGGTGTATGGGTTTGTTTCTGG + Intergenic
1164484828 19:28646137-28646159 TAGAAGTACAGGTTTCTTTTGGG + Intergenic
927630640 2:24771178-24771200 TAAGAGTATACGTTGGTTTTAGG + Intergenic
927974188 2:27325579-27325601 TAGGAGTATAGGCTGGGGTTTGG - Intronic
928684489 2:33734119-33734141 AAAGACTATAGGTTTGTTTTTGG + Intergenic
929128255 2:38540511-38540533 TAGGATGATAGGCTTATATTTGG + Intergenic
930492054 2:52086658-52086680 TAGGTTAATAGATTTGTATTTGG - Intergenic
931490943 2:62746321-62746343 TAGCAGTATAGGTTTGTAGGTGG + Intronic
931950274 2:67354353-67354375 TAGGAGTCTAGGACTGTGTTGGG - Intergenic
935189041 2:100761170-100761192 TAGGAGTTCAGGTTTGCATTTGG + Intergenic
935749363 2:106217277-106217299 CAGGAGTATGGGTTTGTTTCTGG - Intergenic
936121933 2:109754035-109754057 CAGGAGTATGGGTTTGTTTCTGG + Intergenic
936222762 2:110617437-110617459 CAGGAGTATGGGTTTGTTTCTGG - Intergenic
936671127 2:114658145-114658167 TAGGAGTATATGTGTGTAAGGGG + Intronic
936760753 2:115778410-115778432 TTTGAGTATAGTTTTGCATTTGG - Intronic
938870197 2:135467449-135467471 GAAGAGTTAAGGTTTGTATTGGG - Intronic
941055319 2:160781248-160781270 TAGGAGTACAGGTTTATTTCTGG - Intergenic
942248448 2:174027748-174027770 CAGGTGCATAGGTGTGTATTTGG - Intergenic
942359345 2:175155958-175155980 CAGGAGTATATGAGTGTATTAGG + Intronic
942491556 2:176494657-176494679 TTGGAGTAAAGGTTCATATTTGG - Intergenic
943034202 2:182720719-182720741 TATGACTATATGTTTGCATTAGG + Intronic
943178471 2:184509779-184509801 TATGAGTATAGGTGTCTTTTTGG + Intergenic
943872688 2:193021704-193021726 TAGGTGTATATGTTTGTCTTAGG - Intergenic
944806096 2:203282652-203282674 TAGGAGTATTGCTATGTATTTGG + Intronic
945232550 2:207607812-207607834 TAGTAAAATAGGTTTGGATTAGG + Intronic
1170335240 20:15263340-15263362 TAGATGTATAGATTTGTTTTTGG + Intronic
1170755289 20:19198452-19198474 TAGGTATATAGCTTTATATTTGG + Intergenic
1171945961 20:31377926-31377948 TGGGAGTGTAGTTTTGTCTTTGG - Intronic
1175261730 20:57678861-57678883 TGGGAGTATTTGATTGTATTGGG - Intronic
1179261382 21:39761087-39761109 TAGGTGTATGGGTTTATTTTAGG - Intronic
1180521248 22:16207809-16207831 TTTGAATATAGATTTGTATTTGG - Intergenic
1182386537 22:29947419-29947441 TATGAGGATAGGTTTCTATTAGG + Intronic
1183905775 22:41039153-41039175 CAGGAGTTTGGGGTTGTATTTGG - Intergenic
952529847 3:34252158-34252180 AAGGAGCATAGCTTTATATTGGG + Intergenic
952574384 3:34757370-34757392 TAGAAGTTTATTTTTGTATTTGG + Intergenic
956490422 3:69765691-69765713 TAGTAGTTAAGGTTTGGATTAGG + Intronic
957336136 3:78831395-78831417 TAGTAGTTTATGTTTTTATTTGG + Intronic
959042265 3:101436105-101436127 TAGGTGTATGGGTTTGTTTCTGG - Intronic
960719597 3:120612718-120612740 TAGGATTCTAGGTTTTGATTAGG + Intergenic
962468444 3:135683009-135683031 TAGGTGTATGGATTTGTTTTTGG - Intergenic
964180025 3:153872630-153872652 TAGATGTATAGATTTGTTTTTGG - Intergenic
965226029 3:165992006-165992028 TTAGAGTATAGCTTTTTATTAGG - Intergenic
967041823 3:185700660-185700682 TTGGAGTCAATGTTTGTATTTGG - Intronic
969782880 4:9423631-9423653 TAGGAGTGCAGGTATGTTTTGGG + Intergenic
972267862 4:37480570-37480592 TAAGAGTATATATTTGTTTTAGG + Intronic
973762260 4:54128815-54128837 TAGGTGTATAGATTTGTTTCTGG + Intronic
976011805 4:80497940-80497962 TAGGTGTATGGCTTTGTATCTGG - Intronic
976136820 4:81946748-81946770 TATGAGTACAGGTTTGTTTTTGG - Intronic
976681889 4:87766606-87766628 TAGGATTATATCTTTGTCTTTGG + Intergenic
977368829 4:96108081-96108103 TATGAGTATTGTTTTGTCTTAGG - Intergenic
977966992 4:103164032-103164054 TTGGAATCTAGGTTTGGATTAGG + Intronic
978110543 4:104959528-104959550 TAGGAATATTGGTTGGTAGTGGG + Intergenic
978918550 4:114153399-114153421 TAGGAGTATAGTATTGTCTGTGG - Intergenic
984075388 4:175171410-175171432 TAAGAGTAGAGGTATGTTTTGGG - Intergenic
984655396 4:182311939-182311961 TACGACTAAAGGTTTGAATTTGG + Intronic
987806045 5:22769651-22769673 TAGGAGGATGGGGGTGTATTAGG - Intronic
989216764 5:38912757-38912779 TAGGTGTGTAGTTTTGTTTTTGG - Intronic
989762358 5:45032219-45032241 TAGGTATATAGGTATATATTAGG + Intergenic
990824709 5:59885828-59885850 TGTGAGTATAGGTTGGTATGAGG - Intronic
995372208 5:111431192-111431214 TAGGTGTATAGATTTGTTTCTGG - Intronic
999503006 5:152165506-152165528 TAGGAGAATAGGATTCTAATGGG + Intergenic
1000852789 5:166361268-166361290 TAGGAGTAAATGTCTATATTTGG - Intergenic
1003884793 6:10512112-10512134 TAGGAGTACAAGGTTTTATTAGG + Intronic
1006244012 6:32713876-32713898 TAGAATTCTAGGTTTGTGTTAGG + Intergenic
1006818550 6:36871491-36871513 TAGGAGTAAAGGTTGGTTTCTGG + Intronic
1008215642 6:48784827-48784849 TAGGTGTGTAGGTTTGTTTCTGG - Intergenic
1010937680 6:81881416-81881438 TAGGATAACATGTTTGTATTTGG - Intergenic
1011563530 6:88648538-88648560 TAGGTGCAGAGGTTTGTATAGGG - Intronic
1013749533 6:113387090-113387112 TAGGATTACAGGTGTGTTTTGGG + Intergenic
1015681628 6:135814864-135814886 TAAGTGTATAAATTTGTATTGGG - Intergenic
1020944870 7:14590851-14590873 AAGTAGTATAGGTATGTTTTAGG + Intronic
1021161639 7:17280478-17280500 CAGGAGTATATGTGTGTATATGG - Intergenic
1021956250 7:25827566-25827588 TAGGTGTATAGATTTATATCTGG - Intergenic
1022858795 7:34343413-34343435 TAGAAATATATGTGTGTATTAGG - Intergenic
1023184506 7:37518863-37518885 TGGAAGTATAGGTTTGAAGTAGG + Intergenic
1023189072 7:37559791-37559813 GAAGATGATAGGTTTGTATTAGG + Intergenic
1023312518 7:38902485-38902507 CAGGAGTACAGGTTTTTATATGG - Intronic
1024966510 7:55026762-55026784 TAGGAGTATATATTGGTTTTAGG - Intronic
1028744576 7:94312821-94312843 TAGGAGCATATGTATATATTTGG + Intergenic
1030005574 7:105115646-105115668 AAGGAATATACATTTGTATTAGG - Intronic
1030880887 7:114877669-114877691 TAGGTGTATGGATTTGTTTTTGG + Intergenic
1031158260 7:118135877-118135899 CAGGATTACAGTTTTGTATTAGG + Intergenic
1031411397 7:121443974-121443996 TAGGAATATAAATCTGTATTCGG - Intergenic
1031411399 7:121444008-121444030 TAGGAATATAATTCTGTATTCGG - Intergenic
1031411401 7:121444042-121444064 TAGGAATATAATTCTGTATTCGG - Intergenic
1031411403 7:121444076-121444098 TAGGAATATAATTCTGTATTCGG - Intergenic
1031411405 7:121444110-121444132 TAGGAATATAATTCTGTATTCGG - Intergenic
1031520068 7:122753477-122753499 TAGGAGTACAGGTATGTAGTAGG - Intronic
1031877767 7:127161408-127161430 TAGGAGTATAGGCTGGAAATGGG - Intronic
1033501218 7:141951693-141951715 TAGGAGTATACGTGTGTGTTTGG - Intronic
1034003031 7:147437509-147437531 TAGGTGTATAAATTTGTTTTTGG + Intronic
1036538204 8:9673402-9673424 TAGGATAATAGAGTTGTATTTGG + Intronic
1036706600 8:11051442-11051464 TAGGAGTTCAGTTTTGAATTTGG - Intronic
1036836182 8:12070404-12070426 TAGGAGTGCAGGTATGTTTTGGG - Intronic
1036858024 8:12316973-12316995 TAGGAGTGCAGGTATGTTTTGGG - Intergenic
1037091318 8:14922586-14922608 TAGGAATATAGTTTAGGATTAGG - Intronic
1037283803 8:17273633-17273655 TAGGATTACAGGCGTGTATTAGG + Intronic
1040430589 8:47337890-47337912 TAGGTGTATAGGTTTATTTCTGG + Intronic
1041598480 8:59686468-59686490 TAGGAGTATTGGGAAGTATTAGG - Intergenic
1043653767 8:82635192-82635214 TAAGAGTATAAGTTTATTTTAGG - Intergenic
1043698187 8:83248852-83248874 TAGGTTTATAGTTTTGCATTAGG - Intergenic
1044957446 8:97495902-97495924 TAGGTGTATGGATTTGTTTTTGG - Intergenic
1046316962 8:112516567-112516589 AAGGAATATTGGTTTTTATTTGG - Intronic
1046337279 8:112806769-112806791 TAGTGGTATAGGTTTGTGATCGG - Intronic
1047880697 8:129189702-129189724 TAGGGGGATTGGTATGTATTGGG + Intergenic
1047940687 8:129825163-129825185 TAGGAATAAAGGTGTGCATTTGG - Intergenic
1050247206 9:3703300-3703322 AAGGAGTATAAGTTTGTTGTGGG + Intergenic
1050356628 9:4789938-4789960 TAGGGTTATAGATTTGTTTTTGG - Intergenic
1051533325 9:18129787-18129809 TCAGAGCATAGGGTTGTATTTGG + Intergenic
1052548032 9:29905780-29905802 TTGGAGAATACGTTTCTATTCGG - Intergenic
1055042421 9:71889444-71889466 TAAGAGTAGAGGTTTATATTGGG + Intronic
1055586877 9:77764112-77764134 TAGGAGTATAGGTTTGTATTTGG - Intronic
1062140762 9:134957553-134957575 AAGGGGATTAGGTTTGTATTAGG + Intergenic
1186173580 X:6902558-6902580 TAAGGGTATTGCTTTGTATTTGG + Intergenic
1186618028 X:11210096-11210118 CAATAGTATAGTTTTGTATTTGG + Intronic
1187514329 X:19953032-19953054 TAGGAGAATAGATATGTCTTTGG - Exonic
1188694042 X:33166393-33166415 TAGGAGTATGGGTTATTATTTGG - Intronic
1190803958 X:53817589-53817611 TAGGAGAATATGTTTGTGATAGG - Intergenic
1194122257 X:89975787-89975809 AAGGAGTGTAGGTTTGAAGTAGG - Intergenic
1194200274 X:90945939-90945961 TAGAAATATAGGATTGTATAAGG - Intergenic
1194994647 X:100578429-100578451 CAGGTGTATAAGTATGTATTTGG - Intergenic
1195416406 X:104624562-104624584 TGGGAGTATACATTGGTATTAGG + Intronic
1196165006 X:112529157-112529179 TAGGATCATAGTTCTGTATTTGG - Intergenic
1197163100 X:123345667-123345689 AAGGAGTTGAGGTTTGTACTTGG - Intronic
1197234604 X:124045741-124045763 TTGGATGATAGGTATGTATTGGG + Intronic
1197794515 X:130285056-130285078 TAGGAGCATAGCCTGGTATTTGG - Intergenic
1198908257 X:141585521-141585543 TAGAAATATAGGATTGTATAAGG - Intronic
1199271994 X:145895011-145895033 TAGGTGTATAGCTTTATATCTGG + Intergenic
1199856230 X:151761111-151761133 AATGACTATAGATTTGTATTAGG + Intergenic
1200475116 Y:3633222-3633244 AAGGAGTGTAGGTTTGAAGTAGG - Intergenic
1200546270 Y:4522335-4522357 TAGAAATATAGGATTGTATAAGG - Intergenic
1201309412 Y:12582366-12582388 TAGGTGTGTAGATTTGTTTTTGG - Intergenic
1201501286 Y:14645488-14645510 AAGGAGTATCTGTTTATATTTGG - Intronic