ID: 1055586877

View in Genome Browser
Species Human (GRCh38)
Location 9:77764112-77764134
Sequence TAGGAGTATAGGTTTGTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055586877_1055586881 13 Left 1055586877 9:77764112-77764134 CCAAATACAAACCTATACTCCTA No data
Right 1055586881 9:77764148-77764170 GATTGAGTCAGGTGAATTTCAGG No data
1055586877_1055586880 2 Left 1055586877 9:77764112-77764134 CCAAATACAAACCTATACTCCTA No data
Right 1055586880 9:77764137-77764159 CAAGAAAGTGAGATTGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055586877 Original CRISPR TAGGAGTATAGGTTTGTATT TGG (reversed) Intronic