ID: 1055586878

View in Genome Browser
Species Human (GRCh38)
Location 9:77764123-77764145
Sequence ACTTTCTTGTTTAGGAGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055586878_1055586880 -9 Left 1055586878 9:77764123-77764145 CCTATACTCCTAAACAAGAAAGT 0: 1
1: 0
2: 0
3: 18
4: 182
Right 1055586880 9:77764137-77764159 CAAGAAAGTGAGATTGAGTCAGG No data
1055586878_1055586882 24 Left 1055586878 9:77764123-77764145 CCTATACTCCTAAACAAGAAAGT 0: 1
1: 0
2: 0
3: 18
4: 182
Right 1055586882 9:77764170-77764192 GCTTCTAGTCTCAGAGTTGAAGG No data
1055586878_1055586881 2 Left 1055586878 9:77764123-77764145 CCTATACTCCTAAACAAGAAAGT 0: 1
1: 0
2: 0
3: 18
4: 182
Right 1055586881 9:77764148-77764170 GATTGAGTCAGGTGAATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055586878 Original CRISPR ACTTTCTTGTTTAGGAGTAT AGG (reversed) Intronic
903601141 1:24541623-24541645 ACTTTCTTGTAAAGGTGTGTTGG - Intergenic
906469079 1:46112145-46112167 ACATTCTTTTTTAGGATTATAGG - Intronic
907921229 1:58914184-58914206 ACTTTCTTCTTTACTAATATAGG - Intergenic
909047114 1:70723918-70723940 GCTTTCCTGTTTTGGATTATAGG + Intergenic
911626951 1:100134569-100134591 ACATTCTTGTTTTGGAATATGGG + Intronic
915866079 1:159500686-159500708 ACTTTATTCTTAAGGGGTATGGG + Intergenic
922017512 1:221665898-221665920 ACTTTATTTTTTAGCAGTTTGGG + Intergenic
923912547 1:238464679-238464701 ACTTCCTTGCTTAGGACTTTTGG + Intergenic
1063012594 10:2039858-2039880 AATTTCATGTTTAGGAGTTTTGG + Intergenic
1064113960 10:12561884-12561906 AATTCCTTGTTTTGTAGTATGGG - Intronic
1068245872 10:54366981-54367003 ACTCTGATGTTTAGGAGTTTAGG + Intronic
1068304702 10:55192384-55192406 ACTTTTTTATATGGGAGTATAGG - Intronic
1069121545 10:64575387-64575409 TCTTTTTTGTTTAGGATTCTTGG + Intergenic
1069589582 10:69633522-69633544 ACTTTATTGTTTAGGACAAGTGG + Exonic
1069805607 10:71122000-71122022 ATTTTCTTGTTTATGTGCATAGG + Intergenic
1074989405 10:118689833-118689855 ACTTTTTTGTGAAGCAGTATAGG - Intronic
1079471014 11:20777540-20777562 AATTTCTGGTTTTGGAGGATGGG - Intronic
1079786095 11:24674661-24674683 ATTTTGTTGTTTAGGAATACAGG - Intronic
1080468499 11:32521628-32521650 AGTTTCTTGTTTAGCAAAATGGG - Intergenic
1081086015 11:38802268-38802290 GCTTTCTGGATTTGGAGTATAGG - Intergenic
1081142786 11:39523471-39523493 ACCTTCTTTTTTAGTAATATAGG + Intergenic
1084852934 11:71958401-71958423 CCTTTGTTGTTATGGAGTATCGG + Intronic
1088991384 11:114956479-114956501 TCTTTCTTGTTTATGAGAAATGG - Intergenic
1090329766 11:125922083-125922105 ACTTTCCTGTTTGGGAGGGTGGG - Intronic
1091413265 12:258067-258089 ACGTGCTTGTTTAGGAATTTAGG - Intronic
1094724208 12:33095961-33095983 CCTTTTTTTTTTAGGTGTATAGG + Intergenic
1095279202 12:40330289-40330311 ACTTTATTTTTTAGGAATCTAGG + Intronic
1096015040 12:48263611-48263633 ACTTACTTGTTAAGTTGTATAGG + Intergenic
1098877302 12:75879546-75879568 AGTTTCTTGTTTGGTACTATGGG - Intergenic
1099059571 12:77889660-77889682 ACTTTTCTGTTTAGGATTAATGG + Intronic
1101198979 12:102415136-102415158 ACTGTCTTGTGTAGGAGAATAGG + Intronic
1101258778 12:103007614-103007636 ACTTTATTTTGTAGGTGTATTGG + Intergenic
1102074163 12:110046822-110046844 ACTATCTTGATTAGGAGTAGGGG + Intronic
1103430111 12:120876745-120876767 ACTTTCTTTTTTTCCAGTATAGG - Intronic
1106672770 13:31924544-31924566 ATTTTCATGCCTAGGAGTATAGG + Intergenic
1108598420 13:51969990-51970012 ACTTTCAGGTTTAAAAGTATTGG + Intronic
1108707652 13:53004406-53004428 ACATCCTTGTTTAGAAGTACTGG - Intergenic
1109889843 13:68596798-68596820 ACTTTTTTGTTTTTGTGTATTGG + Intergenic
1110801875 13:79707664-79707686 ACTGTCATGTTTATAAGTATAGG + Intergenic
1115424485 14:33241326-33241348 TTTTTCTTGTTTTGCAGTATTGG + Intronic
1116829010 14:49699491-49699513 ACTATCTTGTTTAGAACGATCGG - Intronic
1118645538 14:67835066-67835088 ATTTTCTTGTTTAGGCTTATGGG + Exonic
1120659413 14:87234633-87234655 ACTGTCTTTTTTAAAAGTATAGG + Intergenic
1120802558 14:88708112-88708134 ACTTTCTTGTTTAGCTGCCTTGG - Intronic
1121319046 14:92980437-92980459 CCTTTCTTGTTTTGGGGCATGGG - Intronic
1124392302 15:29269996-29270018 ACACACTTGTTTAGGAGTTTCGG - Intronic
1124583820 15:30987196-30987218 ACTTTCAGATTTAGGAGTAAAGG - Intronic
1124788072 15:32700338-32700360 ACTTACTAGTTGAGGAGTTTTGG - Intergenic
1125415497 15:39448055-39448077 ACTGGCTAGTTTAGGAGTTTAGG - Intergenic
1125445804 15:39754651-39754673 AATTTCTAGTTTAGGAGACTAGG + Intronic
1125451386 15:39811430-39811452 TCTTTCTGATTTAGGATTATAGG + Intronic
1127624034 15:60762972-60762994 ACATTTTTGTTTATGAATATGGG - Intronic
1128573069 15:68749802-68749824 AACTACTTGTTGAGGAGTATAGG + Intergenic
1135674273 16:24402112-24402134 ACTTTCTGGATTAGAACTATGGG - Intergenic
1137909679 16:52364016-52364038 TCTTTCTTTTTTAGAAGTAAGGG + Intergenic
1140329690 16:74042194-74042216 ACTCTCGTGTTTAGGATAATGGG - Intergenic
1142724512 17:1802605-1802627 ACTTTCTTGTTTAGGGTCAAGGG + Intronic
1142738170 17:1914889-1914911 ACTTTCTAGTTAACGAGTTTGGG + Intergenic
1143000642 17:3793010-3793032 ACGTTCTTGTTTGGGGGTAATGG + Intronic
1149159544 17:53674460-53674482 TCATTCTTGTTTACGAGTTTAGG + Intergenic
1155462586 18:26099879-26099901 ACTATCTTGAATAGGAGTAGTGG - Intergenic
1155896790 18:31339843-31339865 ACTTTCTTGTCTGCCAGTATTGG - Exonic
1156133536 18:34007365-34007387 TCTTTCTTTTTGAAGAGTATGGG - Intronic
1156911503 18:42416335-42416357 ACATTTTTCTTTACGAGTATAGG + Intergenic
1157893100 18:51437677-51437699 AATTTTTTGATAAGGAGTATGGG - Intergenic
1159675057 18:71273193-71273215 ACTTCCTTGATTTGGAATATGGG - Intergenic
1161981857 19:7634069-7634091 ACTTTCTTGTTTTGGGGTCTGGG - Intronic
1164690668 19:30208694-30208716 ATTTCATTGTTTAGGAGTGTGGG - Intergenic
1168548130 19:57270792-57270814 TCTATATTGTTTAGGAGTTTTGG + Intergenic
925234422 2:2265618-2265640 ACTTCATTGTTTAAGAGCATGGG + Intronic
929083557 2:38146257-38146279 ACTTTCCTGTTTAGAACTAAAGG + Intergenic
931465371 2:62482071-62482093 ACTTTGTTGGTAAGGAGTAGTGG - Intergenic
933190231 2:79325894-79325916 ACTTGCATGTTTAGGAATGTGGG + Intronic
936776019 2:115974644-115974666 ATTTGCCTGTTTATGAGTATTGG + Intergenic
939549837 2:143601314-143601336 ACTTTCTTGCCAAGGAGTGTAGG + Intronic
940846387 2:158647008-158647030 ACTTCCTTGGTTAGGAGTGCTGG - Intronic
943057385 2:182998930-182998952 ACCTCCTTGGTTAGGTGTATAGG - Intronic
943656778 2:190517747-190517769 ATTTTGTTTTTTAAGAGTATAGG - Intronic
943842099 2:192596646-192596668 GCTTTCTTTTTTAGTAATATTGG - Intergenic
944017868 2:195065537-195065559 TCTTTCTTGTTTAATAATATAGG + Intergenic
944823380 2:203454769-203454791 ACTAACTTGTTAAGGAGTGTTGG + Intronic
945752881 2:213810260-213810282 ATTTTCTGGTTTAAGAGTATTGG + Intronic
945754282 2:213828023-213828045 ACTTTCTTGTTCTTGAATATTGG + Intronic
1177722275 21:24923555-24923577 ACTTTCTTCTTTCCTAGTATAGG + Intergenic
1178042901 21:28660653-28660675 ATTATTTTGTTTAGGAGTTTTGG + Intergenic
1178671305 21:34593978-34594000 ACCCTCTTATTTAGCAGTATAGG + Intronic
1180058007 21:45368984-45369006 TCTTTCCAGTTTAGGGGTATTGG + Intergenic
1182238701 22:28897311-28897333 TCTTTCTTTTTTAGGGGGATCGG + Intronic
1183765145 22:39866411-39866433 ATTATCTTGTTTATGATTATTGG - Intronic
949188542 3:1222892-1222914 AGTTTCTTGTCTATGAGTAAGGG - Intronic
949322754 3:2829355-2829377 TGTTTCGTGTTTAGGAGGATAGG + Intronic
952085483 3:29815423-29815445 ACTATAATGTTTAAGAGTATGGG + Intronic
955972561 3:64450445-64450467 TTGTGCTTGTTTAGGAGTATTGG - Intergenic
956112238 3:65881252-65881274 ACTCTCTTATCTAAGAGTATTGG - Intronic
956907281 3:73779743-73779765 TCTTTCTTTGTTATGAGTATGGG - Intergenic
957363458 3:79189578-79189600 ATTTTCTTTTTTGGGAATATGGG - Intronic
959696852 3:109257580-109257602 TGTTTCTTGTTCAGGAGCATAGG + Intergenic
960965178 3:123099680-123099702 ACTTAGTTGTTTTGGAGTCTTGG + Intronic
961228104 3:125272560-125272582 TTTTTTTTGTTTAGGAGGATAGG - Intronic
963277243 3:143344835-143344857 TCTTTCTTGTTTTGGTGTGTTGG + Intronic
963322231 3:143821576-143821598 AATTTCATTTTTAGGAGAATTGG - Intronic
963462063 3:145627274-145627296 ACTTTCTTTTTTATAAGTTTAGG - Intergenic
963583227 3:147153431-147153453 ACTTTATTGTTTTGTAATATAGG + Intergenic
965403423 3:168241149-168241171 ACTGTCTGGTTCAGTAGTATTGG + Intergenic
966244485 3:177791321-177791343 ACTCTCTTGTTTTGGATTCTGGG + Intergenic
966529060 3:180953687-180953709 ATCTTCTTGTTTTGGATTATGGG + Intronic
970651713 4:18186036-18186058 ACTTTATTGTTAAGGTGGATTGG - Intergenic
971570737 4:28207190-28207212 ACTTTCTTGTTTTCAAGGATAGG - Intergenic
972360184 4:38319356-38319378 ACTTCCTTTTTTAGGGGTTTAGG + Intergenic
972563914 4:40252639-40252661 AATTTCTGGGTTAAGAGTATAGG - Intergenic
975445579 4:74460744-74460766 CCTTTCTTTTTTGGGAGAATGGG - Intergenic
975915359 4:79318862-79318884 AGTTTGTTGTTTAAGAGTATAGG + Intronic
976066691 4:81195875-81195897 AGATTCCTGTTTAGGAATATTGG - Intronic
977246970 4:94644014-94644036 TCTGTCTTGTTTATGAGTCTTGG - Intronic
978118787 4:105053156-105053178 ATTTTCTAGTTTATGTGTATAGG - Intergenic
978703496 4:111676361-111676383 CCTTTGTTGTTTAACAGTATTGG - Intergenic
981158488 4:141469445-141469467 TATTTCTTATTTAGGAGTCTTGG - Intergenic
983426102 4:167584811-167584833 AATTTCTTGTTGTGTAGTATAGG + Intergenic
983493308 4:168413863-168413885 ATCTTCTTGTATATGAGTATTGG - Intronic
984156826 4:176204494-176204516 ACTTTCTTCTTGAGTTGTATAGG - Intergenic
984282353 4:177686612-177686634 ATATTCTTGTTTTAGAGTATGGG - Intergenic
986053658 5:4114077-4114099 ATTTTCATCTTAAGGAGTATGGG - Intergenic
988458560 5:31411127-31411149 ATTTACTTCTTTAGGAGCATTGG + Intronic
989455983 5:41645042-41645064 TTTTTCTTTTTTAGGAGTTTAGG - Intergenic
990674643 5:58169771-58169793 AATTTCATGTCTAGGAGTAGTGG - Intergenic
991435525 5:66594580-66594602 ACTTTCCTATTTAGGAGTTCTGG - Intergenic
991903506 5:71484028-71484050 ATTTTTCTGTTTAGCAGTATGGG + Intronic
992064751 5:73096240-73096262 ACTTCCTTGTTTAAGAGCAAAGG + Intergenic
992695091 5:79278214-79278236 AGTTTCTTGTTTGGTAGAATAGG + Intronic
992724527 5:79592876-79592898 AGTTTCTTGTCAAGGAATATAGG + Intergenic
994284251 5:97944948-97944970 ACTCTCTTGTTTAGTATTTTAGG + Intergenic
995026725 5:107432129-107432151 GCTTTCCAGTTTAGGAGTTTGGG - Intronic
995950121 5:117701774-117701796 ATTTTTTTATTTAAGAGTATTGG + Intergenic
996859015 5:128043726-128043748 ACTTTCTTATTTAAGTGCATAGG + Intergenic
998938035 5:147251354-147251376 ACATTCTTGTTAGGGAGTGTTGG + Intronic
1000346101 5:160314875-160314897 ACTTTTTTGTTAAGGAATTTTGG + Intronic
1001165654 5:169363916-169363938 ACTTTCTTGTCTAGTTGTACTGG + Intergenic
1001872397 5:175168263-175168285 ATTTTCTTATTGAAGAGTATGGG - Intergenic
1004805121 6:19195373-19195395 TCTGTCTGGTTTGGGAGTATTGG - Intergenic
1005032866 6:21527743-21527765 ACTTTCTTGTTTTGCAGTTGAGG + Intergenic
1005033563 6:21534731-21534753 ACTTTCTTGTTTTGCAGTTGAGG + Intergenic
1005336821 6:24805261-24805283 AGTTTTTTGTTTAAGTGTATAGG + Exonic
1008169050 6:48179983-48180005 CCTTTCCTGTTTAGGACTAGAGG - Intergenic
1008923234 6:56864570-56864592 ATTTTCTTGTGTAGTAGTATGGG - Intronic
1011213087 6:84975198-84975220 ATTTCATTGTTTAGAAGTATAGG - Intergenic
1011809124 6:91109604-91109626 ACTTTATTGTTTAGTAGTAGTGG - Intergenic
1012439343 6:99248296-99248318 ACTTCCTTGCACAGGAGTATGGG + Intergenic
1015510092 6:134029904-134029926 TCTTTCTTTTTTGGGAGGATAGG + Intronic
1015579826 6:134712038-134712060 ACTTTCTTATTTAGGCAAATTGG - Intergenic
1016080534 6:139849566-139849588 TGTTTCTTGTTTAGCATTATAGG - Intergenic
1016375991 6:143421221-143421243 GCTTTCTTGTTTTGGAGAAGGGG - Intergenic
1016661341 6:146584723-146584745 ACTTTATTCTTTAAGAGTAGGGG - Intergenic
1018874241 6:167805981-167806003 AGTTGCTTGTTTGGAAGTATCGG + Intergenic
1019566719 7:1686058-1686080 ACTTTTTTTTTTCTGAGTATGGG + Intergenic
1020553558 7:9639941-9639963 ACTTTCTTTTTTAGGAGAACAGG + Intergenic
1021027918 7:15691849-15691871 ACTTTTTTTTTTAGGAATAAAGG + Intergenic
1021271071 7:18586468-18586490 ACTTTATTGTTTTGTATTATAGG + Intronic
1023287462 7:38633667-38633689 AATTTCTTGTTTTGGAGTTTTGG + Intergenic
1023777661 7:43623695-43623717 TCTTTCTAATTTAGGAGCATTGG + Exonic
1026417182 7:70194517-70194539 ACATGCTTGTCCAGGAGTATTGG + Intronic
1028859612 7:95633991-95634013 ATTTTCTTATTTAGTAGTATTGG - Intergenic
1030390928 7:108927806-108927828 ATTTTCTTGTTTATGTGCATAGG + Intergenic
1031031498 7:116740432-116740454 ACTTTCTTCTCTAGGAGAAAAGG - Intronic
1031232890 7:119133175-119133197 TCTTTCTTGTTTATGAATTTTGG - Intergenic
1033032813 7:137844197-137844219 ACTTATTTGTTTTGGAGTAATGG - Intronic
1033788473 7:144762831-144762853 ATTTTCTTGGTTAGAAGTCTTGG - Intronic
1034819236 7:154201560-154201582 ACTTTCTTATTTAGGAGTGAAGG - Intronic
1039211179 8:35216431-35216453 ACTGTCTTTTTTCTGAGTATAGG + Intergenic
1040088900 8:43375127-43375149 ACATTATTGTTTAGATGTATTGG + Intergenic
1041359913 8:57042211-57042233 GATTTCTTGTTAAGGATTATGGG - Intergenic
1041598482 8:59686479-59686501 TTTTTCTAATTTAGGAGTATTGG - Intergenic
1042183615 8:66115424-66115446 AGTTTCTAGTTTGGGATTATGGG + Intergenic
1044334146 8:90957800-90957822 ACTTTGTTCTTTAGGAAAATGGG - Exonic
1044903038 8:96969823-96969845 AATTTCTTTTTTGGGAGTAGGGG - Intronic
1045371841 8:101532267-101532289 ACTTTTTTCTTTTGGAATATTGG - Intronic
1045697601 8:104827791-104827813 AGTTTCTAGTTTAGGAGTCTTGG - Intronic
1045825566 8:106393702-106393724 ACTTTATAGTTTAAGAATATAGG + Intronic
1046374749 8:113362472-113362494 ACTTTCTAGTTAAGGAGAAATGG - Intronic
1046401545 8:113711523-113711545 ACTTTCTTCATTATGAGAATAGG - Intergenic
1050194830 9:3070896-3070918 GATTTCTTTTTTTGGAGTATAGG + Intergenic
1052678755 9:31660910-31660932 AATTTCCTGGTTTGGAGTATTGG - Intergenic
1055586878 9:77764123-77764145 ACTTTCTTGTTTAGGAGTATAGG - Intronic
1060921852 9:127426011-127426033 CCTTTCCTGTTTTGCAGTATGGG - Intronic
1185987920 X:4856611-4856633 ATTTTCTTCTTTATGAGTATAGG + Intergenic
1187014522 X:15312893-15312915 GATTTATTGTTTAGGTGTATTGG + Intronic
1187293875 X:17980571-17980593 AGTGTCTTGTTGAGAAGTATAGG + Intergenic
1188208541 X:27390818-27390840 ACTTTCTTTTTCAGAAGTTTTGG - Intergenic
1189645337 X:43122473-43122495 ACTTTCCTGTTTTGGGGCATTGG + Intergenic
1190143845 X:47872719-47872741 CCTTTCTTGACTAGAAGTATGGG + Intronic
1190957221 X:55207727-55207749 AAATTCTTGGTTAGGAATATTGG - Intronic
1191093051 X:56644388-56644410 CCTTTCTTTTTTAGTAGTCTAGG + Intergenic
1192095967 X:68211186-68211208 CCTTGGTTGTTTAGGAGGATTGG - Intronic
1194396183 X:93389361-93389383 AGTTTCTAGTTTAGGAGAAAGGG - Intergenic
1196611655 X:117721735-117721757 ACTTTGTGCTTTAGTAGTATTGG - Intergenic
1196809207 X:119615194-119615216 ACTTTAATGCTTAGGAGGATGGG + Intergenic
1197584252 X:128325253-128325275 ACTCTATTGTTTAGGAATATAGG + Intergenic
1198759716 X:140018546-140018568 ACTTTCTTGTTAAGTAGCTTAGG + Intergenic
1198779071 X:140215504-140215526 ACTTTCTTGTTAAGTAGCTTAGG - Intergenic
1199695954 X:150342650-150342672 ACTTTCTTATTTTGGGGTCTAGG - Intergenic
1199764245 X:150929382-150929404 ACTTTGTTCTTTAGGATAATTGG + Intergenic
1200789084 Y:7283856-7283878 AGTTTCTTGTTCAAGAGGATGGG - Intergenic