ID: 1055586879

View in Genome Browser
Species Human (GRCh38)
Location 9:77764131-77764153
Sequence TCAATCTCACTTTCTTGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 315}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055586879_1055586882 16 Left 1055586879 9:77764131-77764153 CCTAAACAAGAAAGTGAGATTGA 0: 1
1: 0
2: 1
3: 25
4: 315
Right 1055586882 9:77764170-77764192 GCTTCTAGTCTCAGAGTTGAAGG No data
1055586879_1055586881 -6 Left 1055586879 9:77764131-77764153 CCTAAACAAGAAAGTGAGATTGA 0: 1
1: 0
2: 1
3: 25
4: 315
Right 1055586881 9:77764148-77764170 GATTGAGTCAGGTGAATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055586879 Original CRISPR TCAATCTCACTTTCTTGTTT AGG (reversed) Intronic
902927548 1:19706305-19706327 TAAATCTCAGTTTCTTTTGTCGG - Intronic
904793685 1:33043004-33043026 TCAGTATCTCTTTCTTATTTTGG - Intronic
906423368 1:45688678-45688700 TCAAAATCACTTTCTTCTTAAGG - Intronic
907278565 1:53330065-53330087 CCAGTCTCACTTTCTTATCTGGG + Intergenic
908907639 1:69035202-69035224 TCTATTTCACCATCTTGTTTTGG - Intergenic
909176134 1:72362259-72362281 TAATTCTCATTTTCTTTTTTAGG + Intergenic
909523788 1:76599801-76599823 TCCATCACAATTTATTGTTTTGG + Intronic
909572472 1:77131851-77131873 TCATTCTCTCTGTCTTGTTTTGG + Intronic
910826645 1:91415991-91416013 ATAATCTTACTTTCTGGTTTTGG - Intergenic
912088091 1:106035200-106035222 TCAATGTCAGTTTCTACTTTTGG - Intergenic
912358656 1:109076239-109076261 TGAATCACAGCTTCTTGTTTGGG + Intergenic
912520117 1:110239391-110239413 TAAATTTCACTTTCTTGGTGAGG + Intronic
912712898 1:111962177-111962199 TGAACCTCACTTTCTTTTTCTGG - Intronic
916209684 1:162350123-162350145 AGAATCTCACCTTCATGTTTGGG + Intronic
917589600 1:176462726-176462748 TCAATCTCAGTTTATAATTTAGG - Intergenic
918280598 1:183001212-183001234 TTCATCTCACTCTCTTCTTTTGG + Intergenic
918389734 1:184046362-184046384 TCAATCTCATTCTCTCTTTTTGG + Intergenic
921176110 1:212595866-212595888 TCAAAGTCACTTCCTTGTGTAGG - Intronic
921565105 1:216707495-216707517 TCACCCTAACTTTCTGGTTTTGG - Intronic
921666660 1:217880911-217880933 TTAATCTCTCTATCATGTTTGGG + Intergenic
923906299 1:238388896-238388918 TGAGTCTCACTTCCTTCTTTAGG + Intergenic
924424971 1:243942489-243942511 TCACTCTCATTTTCTTTTTTTGG + Intergenic
924755916 1:246940965-246940987 TTAATCCCACATTCTGGTTTTGG + Intergenic
1063220266 10:3960834-3960856 TCAAGTGCACTTTCTTGCTTTGG + Intergenic
1063389129 10:5637721-5637743 TCAATGTAACTTTCATATTTGGG + Intergenic
1063659065 10:8020937-8020959 TGAACCACACTGTCTTGTTTAGG + Intergenic
1063686391 10:8240845-8240867 TGAATCTCACTTGCTGGTTAAGG + Intergenic
1064231829 10:13535990-13536012 GCAATATCACTGTCTTGTCTCGG - Intergenic
1064728028 10:18301028-18301050 TCCATCTCACTTTCACTTTTGGG - Intronic
1068108253 10:52646369-52646391 TCAATATAGCTTTATTGTTTTGG + Intergenic
1068259500 10:54560821-54560843 TTAACATCCCTTTCTTGTTTCGG - Intronic
1068942278 10:62691739-62691761 TCAGTTTCACTTAGTTGTTTCGG + Intergenic
1070027940 10:72650106-72650128 TCAATGTCTCTTTCTTTTTGAGG - Intergenic
1070567185 10:77612822-77612844 TCATTTTCACTGTTTTGTTTTGG - Intronic
1071047386 10:81398129-81398151 TCAATCTCCCTTTATTTTATTGG + Intergenic
1073781129 10:106839726-106839748 ACAAGCTGACTTTCTTGTTGGGG + Intronic
1074680801 10:115905093-115905115 ACTAGCTCACTTTCTCGTTTGGG - Intronic
1075331555 10:121577834-121577856 TGAAGGTCACTTGCTTGTTTTGG - Intronic
1075857049 10:125638349-125638371 TCTCTCTCTCTTTCTTTTTTAGG - Intronic
1077723570 11:4651249-4651271 TCAATCTCACTTTCTTAGATTGG + Intronic
1078650735 11:13189520-13189542 TCATTCTTTCTTTCTTTTTTTGG + Intergenic
1079909883 11:26296606-26296628 TCATTCTTACTATCTTGTGTTGG + Intergenic
1080338880 11:31233351-31233373 GGAAGCTAACTTTCTTGTTTTGG - Intronic
1081297124 11:41405183-41405205 TAAATGTCACCTTCTTGGTTTGG - Intronic
1083973643 11:66099532-66099554 TCTATATCATTTTCTTTTTTGGG + Intronic
1086222592 11:84467169-84467191 TCAAATTGACTTTCTTGTTCTGG - Intronic
1087012081 11:93523970-93523992 TCATCCTCTCCTTCTTGTTTTGG + Intronic
1087184959 11:95179977-95179999 TCTATCTCACTTTTTATTTTAGG + Intronic
1087273805 11:96140253-96140275 TCATTTTCACCTTCTTGCTTTGG + Intronic
1087541306 11:99524172-99524194 TCAATCACAGTTTCTGGTCTGGG + Intronic
1088925862 11:114301886-114301908 TCTATCTCACTCTCTTGTCCTGG + Intronic
1090112251 11:123925643-123925665 ACAATGTCACTTTCTGTTTTGGG + Intergenic
1090733807 11:129593892-129593914 TCAGTCTCACTTTCTAGGTATGG + Intergenic
1091079276 11:132651309-132651331 TGAATCTCACTTTCTGGTCTTGG + Intronic
1091396455 12:156605-156627 TAAATTTCACTTTCTCATTTAGG - Intronic
1092294138 12:7184791-7184813 TCAATCTTACTCTCCTGTCTCGG + Intergenic
1093295148 12:17380743-17380765 TAAAGCAAACTTTCTTGTTTTGG + Intergenic
1093390973 12:18620720-18620742 TGAATGTCAGTTTCTTCTTTTGG - Intronic
1094193714 12:27723577-27723599 TCCATCTCAGTTTCTTCTTAGGG + Intronic
1094739616 12:33274147-33274169 TCAATATAAGTTTCTTCTTTGGG + Intergenic
1095580831 12:43795882-43795904 ACAGTTTCACTTTCTTCTTTTGG + Intronic
1098962026 12:76748552-76748574 TCTATCTTACTTTGTTGTCTTGG - Intergenic
1099495146 12:83338401-83338423 TCTGTCTCACTTTCTTCTCTTGG + Intergenic
1100293939 12:93243198-93243220 GCACTCTGACTTGCTTGTTTTGG + Intergenic
1101593932 12:106147090-106147112 TCATTCTCACTCTCTTTTCTGGG - Intergenic
1102148899 12:110674962-110674984 TTAATCTCATTTTCTTATTCAGG - Intronic
1102778923 12:115546681-115546703 TCAACATCACTTTCTTTTCTGGG - Intergenic
1102858777 12:116317720-116317742 ACAATCTCACTCTCTTGCTCAGG + Intergenic
1103669305 12:122599030-122599052 TGAATCTCACTGTGTTGTCTGGG + Intronic
1104493697 12:129216928-129216950 TCAATTTAACTTACTCGTTTTGG - Intronic
1104814032 12:131635742-131635764 TAAATCTCACTTTCTTTTCCAGG - Intergenic
1105091444 13:16295999-16296021 TCAATCTCAGAATCTTCTTTGGG + Intergenic
1105098325 13:16409266-16409288 TCAATCTCAGAATCTTCTTTGGG + Intergenic
1105104218 13:16505612-16505634 GCAATCTCAGAATCTTGTTTGGG + Intergenic
1105106309 13:16539727-16539749 TCAATCTCAGAATCTTCTTTGGG + Intergenic
1105107746 13:16562928-16562950 GCAATCTCACAATCTTCTTTGGG + Intergenic
1105153283 13:17306730-17306752 GCAATCTCACAATCTTCTTTGGG + Intergenic
1105398874 13:20070283-20070305 TCAATCTGACTTTCTGGCTGTGG + Intronic
1105596987 13:21848073-21848095 TCAATCTGAGTTTCTCCTTTGGG - Intergenic
1106112433 13:26788792-26788814 TCAATCTGACTATCTCCTTTTGG + Intergenic
1107855421 13:44610930-44610952 TCTCTCTCTCTTTCTTGTTGGGG - Intergenic
1108776406 13:53770456-53770478 ACAAGCTGACTCTCTTGTTTGGG - Intergenic
1108839767 13:54598028-54598050 ACAATCTCACTTTTTTTTTACGG - Intergenic
1109616496 13:64840666-64840688 ACAAGCTGACTTTCTTGTTAAGG - Intergenic
1109792880 13:67272757-67272779 GCCATTTCACATTCTTGTTTAGG - Intergenic
1109907165 13:68858861-68858883 TAAATCTCAAGTTATTGTTTTGG - Intergenic
1110524184 13:76516427-76516449 TCAAACTCACTTTCTTCTTAGGG - Intergenic
1110779680 13:79450154-79450176 TTAATCTCAGTTTATTATTTAGG + Intergenic
1110961344 13:81630179-81630201 TCTTTCTCACTTTCTTCTGTGGG + Intergenic
1111032177 13:82616698-82616720 TCAATTTCACTTCCTTGTAATGG - Intergenic
1111098642 13:83549022-83549044 TAAATCTCATTTTTCTGTTTTGG - Intergenic
1112853413 13:103734865-103734887 TCAATATCAGTTTCCTGTGTGGG + Intergenic
1114369765 14:22074051-22074073 AGAATCACACTTTCCTGTTTGGG + Intergenic
1115136364 14:30113484-30113506 ACAGTCTGACTCTCTTGTTTGGG + Intronic
1115374275 14:32655835-32655857 CCAATCTAACTTTTTTGTCTAGG + Intronic
1117671332 14:58109582-58109604 TCAATTTCTTTTTCTTCTTTAGG + Intronic
1118338544 14:64876165-64876187 ACAATCTCACTTTATTGTCCAGG + Intronic
1118969708 14:70623950-70623972 TCAATTTCTGTTTCTTGATTGGG - Intergenic
1120442852 14:84561131-84561153 TAAAACTCACTTCCTTATTTGGG - Intergenic
1120729903 14:87991050-87991072 TCTGCCTCACTTTCTTTTTTTGG - Intronic
1121766930 14:96495736-96495758 TCCTTCTCACTTTATTTTTTGGG + Intergenic
1124078667 15:26470727-26470749 TTACTGTCACTTACTTGTTTGGG + Intergenic
1125099518 15:35894967-35894989 ACAGTCTGACTTTCTTGTTAGGG - Intergenic
1126280479 15:46941917-46941939 GCAATCCTACTTTCTTCTTTTGG - Intergenic
1128006870 15:64250745-64250767 TCTTTCTTTCTTTCTTGTTTTGG - Intronic
1128409807 15:67383532-67383554 TTAATCACACTTTATTCTTTAGG + Intronic
1128915365 15:71555672-71555694 ACACTCTCTTTTTCTTGTTTAGG + Intronic
1128919195 15:71594794-71594816 TCTATCTCTCTTTCTTGACTAGG - Intronic
1130353438 15:83110135-83110157 TCAATCTAATTTTCTTTTTCTGG - Intronic
1130731133 15:86493296-86493318 TGCCACTCACTTTCTTGTTTGGG + Intronic
1130799979 15:87252857-87252879 TCTTTCCCACTTTCTTTTTTGGG + Intergenic
1134285060 16:12854070-12854092 TCCATCTTAGTTTATTGTTTTGG + Intergenic
1135496331 16:22954759-22954781 TTAATCTTAATTTCTTGGTTTGG + Intergenic
1135907320 16:26524873-26524895 TTATTCTCCATTTCTTGTTTTGG - Intergenic
1137320225 16:47373124-47373146 TCAATATCTCTTTCATGTTCTGG + Intronic
1140179831 16:72704242-72704264 TTAATCTCCCTTTTTTTTTTTGG + Intergenic
1140565164 16:76033457-76033479 TAAATCTCACCACCTTGTTTTGG + Intergenic
1140780387 16:78291075-78291097 TCTCTCTCTCTTTCTTCTTTTGG + Intronic
1141294380 16:82753253-82753275 TCAATCTCTCTTTATTATTTTGG + Intronic
1141943588 16:87295005-87295027 CTAATCTGACTCTCTTGTTTTGG - Intronic
1144847610 17:18228152-18228174 TCTATTTTACTTTTTTGTTTTGG - Intronic
1145410021 17:22651074-22651096 TAAATATCTCTTTCTTTTTTTGG - Intergenic
1146112237 17:30100463-30100485 TAAATCTCACCTTCTTGATAAGG - Intronic
1146311813 17:31775039-31775061 TCAATGTCAATTTCCTGATTTGG - Intergenic
1148619974 17:49027078-49027100 TCTATCTGCCTTTCTTCTTTTGG - Intronic
1149083790 17:52689796-52689818 TTTATCTCACTTTATTCTTTCGG + Intergenic
1149259839 17:54867175-54867197 CCAATATCTATTTCTTGTTTTGG - Intergenic
1149373943 17:56024662-56024684 TTAATCTCATTTTCCTCTTTGGG + Intergenic
1151099030 17:71534238-71534260 TCCATGTAACTTTCTTTTTTAGG - Intergenic
1151320669 17:73350483-73350505 ACAATCTCAATCTCTTATTTTGG - Intronic
1151626564 17:75279832-75279854 GATATCTCACTTTGTTGTTTGGG + Intronic
1152994797 18:396557-396579 TGAATCTCTTTTTCTGGTTTTGG + Intronic
1155695701 18:28683149-28683171 TCAGTCTCACTCTATTGTTGAGG - Intergenic
1156055934 18:33003001-33003023 TCAATCTCACTATTTGCTTTTGG - Intronic
1156754345 18:40503447-40503469 AGAAACTAACTTTCTTGTTTGGG - Intergenic
1157617741 18:48997210-48997232 TGAAGCTGACTTTGTTGTTTGGG + Intergenic
1157749886 18:50168694-50168716 CCCTCCTCACTTTCTTGTTTTGG + Intronic
1158320430 18:56256217-56256239 TCCATATCCATTTCTTGTTTGGG - Intergenic
1159260597 18:66006740-66006762 TCTCTCTCTCTTTTTTGTTTGGG + Intergenic
1164242332 19:23400426-23400448 GTAATGTCACTCTCTTGTTTGGG - Intergenic
1164886779 19:31784949-31784971 TCTATTTCACTCTCTTGTTGTGG - Intergenic
926979247 2:18549675-18549697 ACAGTCTGACTCTCTTGTTTGGG + Intergenic
927335181 2:21913703-21913725 TCAATGACAATATCTTGTTTTGG + Intergenic
927623984 2:24693225-24693247 TCAATTTCCCCGTCTTGTTTTGG + Intronic
929174825 2:38966039-38966061 TCACTTTCTCTTTCTTCTTTGGG - Exonic
929895183 2:45953528-45953550 TCAATGTCATTTTTTAGTTTAGG - Intronic
930500867 2:52215607-52215629 TCATTTTCACTTTATGGTTTTGG + Intergenic
930607590 2:53508647-53508669 TAAGTCTCACTTTCTTATCTCGG + Intergenic
931060815 2:58527499-58527521 CCAATCCCACTTTGTTATTTAGG - Intergenic
931155437 2:59623401-59623423 TCAGTATCAATTTTTTGTTTTGG + Intergenic
933061132 2:77737952-77737974 TCTCTCTCAGTTTGTTGTTTAGG + Intergenic
934944395 2:98527597-98527619 TCAATCTCAGGTAATTGTTTAGG - Intronic
935013585 2:99158400-99158422 TGAATCTCACTTTGTTGTCCAGG - Intronic
935343674 2:102083184-102083206 TGAATCTCACTTTCCTGATGTGG - Intronic
935484533 2:103637327-103637349 TAAATCTGAGTTTCTTATTTTGG + Intergenic
935609659 2:105008104-105008126 TCAATGTCTTTTTCTGGTTTTGG - Intergenic
935662626 2:105481762-105481784 CCATTCTCATTTTCTTGTATTGG - Intergenic
936370093 2:111896701-111896723 CAAATCTCACTTTCTTGTTGAGG - Intergenic
938451945 2:131428789-131428811 TAAATCTCTCTGTCTTGTGTTGG - Intergenic
940181063 2:150933437-150933459 TCAAACTCATTTTCTTATATAGG - Intergenic
940399915 2:153236439-153236461 ACAAGCTGACTTTCTTGTTGGGG + Intergenic
940555019 2:155213567-155213589 TGAATCTCAATTTCTGGTATTGG + Intergenic
940714712 2:157207547-157207569 TCAATCTCATTTTCTTAATATGG + Intergenic
941073394 2:160980281-160980303 GCAATGTCACTTTCTACTTTAGG - Intergenic
942788296 2:179728358-179728380 TTAGTCTCAATTCCTTGTTTTGG + Intronic
942843413 2:180392992-180393014 TCACTTTAATTTTCTTGTTTTGG + Intergenic
945025316 2:205615030-205615052 GCAAACTCACTGCCTTGTTTAGG + Intronic
945487190 2:210410330-210410352 TCACTCTGACTCTCTTGTTAGGG - Intergenic
945503542 2:210608896-210608918 TCTATATTACTTTCTTGATTTGG - Intronic
945618511 2:212104925-212104947 GCAGTCTCAGTTTCTTGTTTAGG - Intronic
945820761 2:214662416-214662438 TCAATCTCAACTTCTTGTCCTGG + Intergenic
946472918 2:219979394-219979416 TCAGCCTCACTTTCCTTTTTGGG + Intergenic
1168778890 20:471976-471998 TCCATCTCCCTTACTTTTTTAGG + Intergenic
1169253174 20:4075764-4075786 TCAATGTCACTTCCCAGTTTGGG - Intergenic
1169737397 20:8851690-8851712 TCCATCTCCATTTCTTTTTTTGG + Intronic
1170151266 20:13228891-13228913 TCAACCCCAGTGTCTTGTTTAGG + Intronic
1170955918 20:20979210-20979232 TCTATCTCACTTTCTGCTTGGGG - Intergenic
1175320453 20:58083702-58083724 ACAGTCTCACTATGTTGTTTAGG + Intergenic
1175836073 20:61995541-61995563 TCAATCTTACTTTCTTCTGCTGG - Intronic
1177329873 21:19644743-19644765 TCAATCTTACTGTCCTCTTTTGG + Intergenic
1178434419 21:32545391-32545413 TCCATCCCATTTTCTTGCTTTGG - Intergenic
1182608854 22:31529664-31529686 CTAATCTCACTTTATTGTTGTGG - Intronic
1183521005 22:38296001-38296023 TCAATCTCATTTCCATGCTTGGG + Intronic
1183806346 22:40214431-40214453 TCAATGTCAGTTTCTTCGTTGGG + Intronic
1184269066 22:43367754-43367776 TCAATATTCCTTTATTGTTTTGG + Intergenic
949146353 3:705255-705277 ACAATCTCACTGTCTTGATTTGG - Intergenic
949913550 3:8937402-8937424 TCAATGTCATTTTCGTGTTTGGG - Intronic
950381190 3:12616862-12616884 GCAATTTCACTTTTCTGTTTTGG + Intronic
951287346 3:20829775-20829797 ACAATTTTATTTTCTTGTTTTGG + Intergenic
951375272 3:21907025-21907047 TCAATATCACTTTCTAGTGCTGG + Intronic
952014009 3:28935324-28935346 TCAATGCCATTTTCTTCTTTAGG - Intergenic
952117169 3:30196594-30196616 TCAATCTCACTTTCAGATTTGGG - Intergenic
952244703 3:31574334-31574356 TCAATGTTAATTTCTTGTCTTGG + Intronic
953211871 3:40883024-40883046 TCCATCTCTCTTCCTTCTTTGGG - Intergenic
953820035 3:46200089-46200111 TCCATATCAGTTTCCTGTTTTGG + Intronic
953993844 3:47504448-47504470 TCACTCTCTTTTTCATGTTTAGG - Exonic
955052804 3:55429119-55429141 TCAATGGCCCTTTATTGTTTAGG - Intergenic
956556750 3:70532274-70532296 TCAATCTCACAATCTTGCTCGGG - Intergenic
956585749 3:70862710-70862732 TCAATCTAAATCTCTTGTATAGG + Intergenic
956587593 3:70881063-70881085 TCAATTTCACCTTCTTGTTCAGG - Intergenic
957361775 3:79168906-79168928 TAAATGTCACTTTCTCATTTAGG - Intronic
957997937 3:87714934-87714956 TCCATCTCACTTTCTGGCTATGG - Intergenic
958085840 3:88805197-88805219 CCAATGTAGCTTTCTTGTTTTGG - Intergenic
959240036 3:103779611-103779633 TCAATATCACATACTTGTTATGG - Intergenic
959350640 3:105257965-105257987 TCAATATCACTTTTTTCTCTGGG - Intergenic
959484487 3:106910953-106910975 TCAAACTCACTGTCTTAATTTGG - Intergenic
959510809 3:107209565-107209587 TGTATCTCACTTTCTTGTTGTGG + Intergenic
959860441 3:111209341-111209363 TCCAGCTCACTTTCTTGTATGGG + Intronic
959940454 3:112075599-112075621 TCAATTGCACTTTCATTTTTTGG + Intronic
962475639 3:135752854-135752876 TCAATCCCACTTTGCTGTTCAGG - Intergenic
963660039 3:148113949-148113971 TCAATCACTCTTTCTTAATTGGG - Intergenic
963761786 3:149292283-149292305 TAAATCTCACTGTCTAATTTGGG + Intergenic
964183040 3:153910635-153910657 TCAATCTCACTTTGGTTTTCAGG + Intergenic
964766939 3:160188605-160188627 TGAACTTCACTTTCTAGTTTTGG + Intergenic
964792287 3:160463568-160463590 TCAAGCTGACTCTCTTGTTATGG - Intronic
966675837 3:182588618-182588640 TCAAGCTCACTTTCTGGCTTTGG - Intergenic
967479533 3:189957733-189957755 TCAATCTATCTTTCTTGTTTTGG - Exonic
968712408 4:2128500-2128522 TCAATGTCACTTTGTTGATGGGG - Intronic
971715187 4:30166662-30166684 TTATTCTCAATTTCTTTTTTTGG - Intergenic
971868960 4:32210848-32210870 TGAATTTCACTTTCTTTTATAGG + Intergenic
972613491 4:40676482-40676504 CCATTCTCACTGTCTTTTTTTGG + Intergenic
974362988 4:60907102-60907124 TCAATTTCACATTCCTGTTAGGG + Intergenic
975833659 4:78397826-78397848 TCAATCTTACTTTCCTCTGTAGG + Intronic
976175536 4:82347921-82347943 TGAATCTCACTTTATTGTCCAGG - Intergenic
976417961 4:84801184-84801206 CCAATATCAATTTCTTGGTTTGG + Intronic
978814439 4:112886702-112886724 TCAATTTTACATTCTTTTTTAGG - Intronic
979384323 4:120046114-120046136 ACAAGCTGACTTTCTTGTTAGGG - Intergenic
979387575 4:120087306-120087328 ACAATACCACTTTCTTGTTTGGG - Intergenic
979620126 4:122789260-122789282 TACATCTTTCTTTCTTGTTTTGG + Intergenic
979689461 4:123545313-123545335 TCACTCTCACTTTCTATCTTTGG + Intergenic
979927384 4:126583813-126583835 TCAGTCTCACTGTCTTCTTCCGG - Intergenic
979941240 4:126765814-126765836 TCAATATTAATTTCTTGATTGGG + Intergenic
981845366 4:149161799-149161821 TCTATCTCACCTCCTTTTTTGGG + Intergenic
982453562 4:155580547-155580569 TCAGGCTAACTTTCTTGTTAGGG + Intergenic
982558192 4:156895840-156895862 TCACTGTAACTTTCCTGTTTTGG - Intronic
985424023 4:189811045-189811067 TGTTTCTCACATTCTTGTTTGGG + Intergenic
985581153 5:695843-695865 TCAATGTGACTTTCTTGGGTGGG + Intergenic
985595777 5:787175-787197 TCAATGTGACTTTCTTGGGTGGG + Intergenic
986154250 5:5158020-5158042 TAAATGTCACTTTGTTCTTTAGG + Intronic
986394834 5:7318411-7318433 TCAATTTCAGTTCCTTGTTTGGG - Intergenic
987357797 5:17080679-17080701 TTCCTCTCCCTTTCTTGTTTTGG + Intronic
988280221 5:29135581-29135603 TGAGTCTCACTATCTTGTTTAGG + Intergenic
988832549 5:35002245-35002267 TCATTCTGGCTTTGTTGTTTGGG + Intronic
989433101 5:41378257-41378279 TGAAGCTCAGTTTTTTGTTTTGG - Intronic
990119393 5:52431229-52431251 TTCATCTCACTATTTTGTTTGGG - Intergenic
992972666 5:82078757-82078779 TCATACACACTTTCTTTTTTTGG - Intronic
995856808 5:116601121-116601143 TCACTCTTCCTTTCTGGTTTAGG - Intergenic
995922668 5:117332404-117332426 TGAAACCCATTTTCTTGTTTTGG + Intergenic
996659973 5:125990215-125990237 TCAATATAACTTTCATGGTTGGG + Intergenic
996833194 5:127762687-127762709 TAAATGTGACTTTCTTGTCTTGG + Intergenic
997037568 5:130211578-130211600 TCCATCTTAGTTTTTTGTTTAGG + Intergenic
998708596 5:144794299-144794321 TCAATCTCACTATCTGCTATTGG + Intergenic
998782629 5:145674907-145674929 TGAATCTCACTCTGTTGTTCAGG - Intronic
1000571874 5:162924802-162924824 TCAATCTCTCTTTAATGCTTTGG + Intergenic
1003013357 6:2447352-2447374 TTATTCTCTCTTTCTTGTGTAGG + Intergenic
1004295336 6:14405040-14405062 TCATTCTCACTCCCTTGCTTTGG + Intergenic
1004474217 6:15956188-15956210 TCAATTTCACTTTCCTTTTTAGG - Intergenic
1005417910 6:25621164-25621186 TCCATCACACTGTATTGTTTTGG - Intergenic
1005447124 6:25935868-25935890 TGAATCTGACTTTCTTCCTTAGG + Intergenic
1006536018 6:34699375-34699397 TCAGTCTCCCTTTTTTTTTTAGG + Intergenic
1006994907 6:38250188-38250210 TCAATTTCATTTTCTTTTTGTGG - Intronic
1008831582 6:55770101-55770123 ACAATCTGACTCTCTTGTTATGG - Intronic
1010194744 6:73227944-73227966 GAAGTCTCACTTTGTTGTTTGGG - Intronic
1011101489 6:83727707-83727729 TCTCTCTCTCTTTCTTTTTTTGG - Intergenic
1013453421 6:110307719-110307741 TTATTCTCCCTTTCTTTTTTTGG - Intronic
1014896681 6:126909517-126909539 TCACTTTTAATTTCTTGTTTTGG - Intergenic
1016276523 6:142359538-142359560 TACATCTCAGTTTCTTGATTTGG + Intronic
1016321610 6:142852716-142852738 TCACTATCACATTCTAGTTTAGG + Intronic
1016630459 6:146223851-146223873 TAAAACTCACTTTCTTGTGATGG - Intronic
1017616264 6:156249888-156249910 TCAACCTCATTTTCTTGCTTTGG - Intergenic
1017951368 6:159137607-159137629 TCAGTTTCACGTTCTTGTTCAGG + Intergenic
1020031444 7:4935758-4935780 CCAATGTCAGTTTCTTGCTTTGG + Intronic
1020553557 7:9639933-9639955 TTAAGCTGACTTTCTTTTTTAGG + Intergenic
1021179815 7:17493194-17493216 CCAACCTCAGTTTTTTGTTTTGG - Intergenic
1022636644 7:32142487-32142509 CCAATCCCACTTTCTTGTCCAGG + Intronic
1022731898 7:33034456-33034478 TAAAACTTATTTTCTTGTTTGGG - Intronic
1022818450 7:33935569-33935591 TCTTTCTCTCTTTCTTTTTTGGG - Intronic
1022978600 7:35581055-35581077 TCAATCACATTCTATTGTTTAGG + Intergenic
1023431328 7:40094384-40094406 TCAATCCCACCTTCTCTTTTGGG - Exonic
1026401234 7:70015376-70015398 TTAACCTCAATTTTTTGTTTTGG - Intronic
1026615086 7:71894951-71894973 TGAATTTCATTTTCTTTTTTTGG + Intronic
1027550792 7:79592036-79592058 TTAAACACAGTTTCTTGTTTTGG - Intergenic
1027942370 7:84699854-84699876 TGAGTCTCACTTTCTTGTCCAGG - Intergenic
1029484052 7:100828630-100828652 TCACTCTCACTCTCGTGTTTTGG + Intronic
1030499579 7:110342745-110342767 TCTTTCTCACTTTCTTCTTTAGG + Intergenic
1030732901 7:113010572-113010594 TCAATGTCACTTTGTCTTTTTGG - Intergenic
1032304264 7:130717878-130717900 ACAATGTTACTTTTTTGTTTTGG + Intergenic
1032898893 7:136283797-136283819 TCAATGGCACTTTTTTTTTTTGG + Intergenic
1034635237 7:152562069-152562091 TCAGTCTCACTCTCATGCTTTGG - Intergenic
1034706515 7:153150500-153150522 TCAATTACACTTTCTTGAGTAGG - Intergenic
1034726736 7:153343235-153343257 TCATTCCCACTTTCTCTTTTGGG + Intergenic
1035006151 7:155662649-155662671 TCAATTTGACTTTCTTGGTGTGG + Intronic
1035953274 8:4047813-4047835 TCAATGCCACTTTCTTATTGAGG - Intronic
1036071629 8:5447220-5447242 GCAATCTCTGTATCTTGTTTGGG - Intergenic
1038179201 8:25210761-25210783 TCAGTCCCTCTTTTTTGTTTTGG - Intronic
1038793871 8:30692909-30692931 TCAATCACACTTTCTGCTTGTGG - Intronic
1039891603 8:41689474-41689496 TCAATCTCTCTTTTCTTTTTGGG - Intronic
1041001294 8:53456880-53456902 TCATTCTCACTTTCTCCTGTGGG + Intergenic
1041740188 8:61149788-61149810 TCTATTTCACCTTCTAGTTTTGG - Intronic
1042068503 8:64904673-64904695 ACAATCTCACTCTGTTGTTCAGG + Intergenic
1042901853 8:73736863-73736885 TCAAGATTACTTTCTTTTTTTGG + Intronic
1043638176 8:82413091-82413113 TCAATTTCAATTTTTTGATTTGG + Intergenic
1044411113 8:91884277-91884299 TTCATGTCACTTTCTTTTTTGGG + Intergenic
1047386524 8:124415257-124415279 TCAGTCTCACCATCCTGTTTGGG - Intergenic
1048550050 8:135425765-135425787 TCATTCTCACTTTCTTCATTTGG + Intergenic
1048562356 8:135554630-135554652 TCAATCACAGTTACTTGTATTGG + Intronic
1050337120 9:4600365-4600387 TCAACCTGACTTTCTCTTTTCGG - Intronic
1052360239 9:27547748-27547770 TCAAGCTCACTTTCTTTCTGTGG + Exonic
1052568854 9:30194764-30194786 CCATTACCACTTTCTTGTTTTGG + Intergenic
1053296299 9:36916036-36916058 TCAATCTCACTTTGTTGTCCAGG - Intronic
1055586879 9:77764131-77764153 TCAATCTCACTTTCTTGTTTAGG - Intronic
1057327824 9:94082083-94082105 GGAATCTCACTTTGTTGCTTAGG - Intronic
1058109776 9:101019308-101019330 TTAATCTAATTTTCCTGTTTTGG + Intergenic
1058980832 9:110168726-110168748 TCAATCCCAGTGTCTGGTTTGGG + Exonic
1059576743 9:115497585-115497607 TCAATCTCATTTTCGTTTTAAGG + Intergenic
1059815401 9:117907203-117907225 TCACTGTCTCTTTCTTTTTTTGG + Intergenic
1186034513 X:5406651-5406673 TCATCTTCTCTTTCTTGTTTTGG + Intergenic
1186800046 X:13083764-13083786 TCAGTCTCACTCTGTTGTCTGGG - Intergenic
1187478558 X:19633911-19633933 TTAATCTCACTCTCTTTTGTTGG + Intronic
1188469263 X:30518753-30518775 ACAGGCTGACTTTCTTGTTTGGG + Intergenic
1188905916 X:35791814-35791836 TCAATGTCAATTTCCTGGTTTGG - Intergenic
1192029715 X:67496053-67496075 TCACTCTCTCTCTCTTTTTTTGG - Intergenic
1192082607 X:68062986-68063008 TCATTCTCCCTTTCCAGTTTGGG - Intronic
1192412890 X:70950420-70950442 TAAATTTCACCTTCTTGGTTTGG - Intergenic
1192551894 X:72061185-72061207 TCAATCCCTTTTTCTTTTTTCGG + Intergenic
1193551439 X:82897643-82897665 TCACTCTCACTTTCTCCTGTGGG + Intergenic
1194267484 X:91773039-91773061 TCAATCTCAATATATTGCTTTGG + Intergenic
1194984891 X:100479687-100479709 TTTATCTCACTGTCTTATTTTGG - Intergenic
1195232477 X:102864296-102864318 AAAATCTCACTTTTTTTTTTTGG + Intergenic
1196034035 X:111123325-111123347 TCATTTTCACTTTCTTTCTTAGG + Intronic
1196149624 X:112358727-112358749 TCACTCTCACTATATTATTTAGG + Intergenic
1196652332 X:118180597-118180619 TCAATTACACTTTCTATTTTAGG + Intergenic
1197097687 X:122614769-122614791 TCAATTTAAGTTTCTTGTTTAGG - Intergenic
1197107145 X:122730200-122730222 GCAATTTCACTTCCTTGGTTGGG - Intergenic
1197556052 X:127955513-127955535 TCAATCTCAGTTTCCACTTTAGG - Intergenic
1197681801 X:129393404-129393426 TGAGTCTCATTTTCATGTTTTGG - Intergenic
1197825269 X:130582888-130582910 ACAATCTCTATTTTTTGTTTAGG - Intergenic
1198174013 X:134136672-134136694 TCCATTTCACCTTGTTGTTTTGG + Intergenic
1199182466 X:144874829-144874851 TCAAGTTCACTTTTTTTTTTTGG + Intergenic
1200353380 X:155522361-155522383 CCAATACCACTTTCTTGGTTTGG - Intronic
1200584692 Y:4993977-4993999 TCAATCTCAATATATTGCTTTGG + Intergenic
1201480398 Y:14432655-14432677 AGAATCTCACTTTGTTGCTTAGG - Intergenic