ID: 1055586881

View in Genome Browser
Species Human (GRCh38)
Location 9:77764148-77764170
Sequence GATTGAGTCAGGTGAATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055586877_1055586881 13 Left 1055586877 9:77764112-77764134 CCAAATACAAACCTATACTCCTA No data
Right 1055586881 9:77764148-77764170 GATTGAGTCAGGTGAATTTCAGG No data
1055586879_1055586881 -6 Left 1055586879 9:77764131-77764153 CCTAAACAAGAAAGTGAGATTGA No data
Right 1055586881 9:77764148-77764170 GATTGAGTCAGGTGAATTTCAGG No data
1055586878_1055586881 2 Left 1055586878 9:77764123-77764145 CCTATACTCCTAAACAAGAAAGT No data
Right 1055586881 9:77764148-77764170 GATTGAGTCAGGTGAATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055586881 Original CRISPR GATTGAGTCAGGTGAATTTC AGG Intronic