ID: 1055588477

View in Genome Browser
Species Human (GRCh38)
Location 9:77783610-77783632
Sequence CTGAGCAGTGGGAAGGTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 549
Summary {0: 1, 1: 1, 2: 7, 3: 34, 4: 506}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055588477_1055588485 27 Left 1055588477 9:77783610-77783632 CCACCTACCTTCCCACTGCTCAG 0: 1
1: 1
2: 7
3: 34
4: 506
Right 1055588485 9:77783660-77783682 TTGTTCTGTCTTCTAACCTAGGG No data
1055588477_1055588484 26 Left 1055588477 9:77783610-77783632 CCACCTACCTTCCCACTGCTCAG 0: 1
1: 1
2: 7
3: 34
4: 506
Right 1055588484 9:77783659-77783681 CTTGTTCTGTCTTCTAACCTAGG No data
1055588477_1055588482 -8 Left 1055588477 9:77783610-77783632 CCACCTACCTTCCCACTGCTCAG 0: 1
1: 1
2: 7
3: 34
4: 506
Right 1055588482 9:77783625-77783647 CTGCTCAGTTATTACTACTTAGG No data
1055588477_1055588483 1 Left 1055588477 9:77783610-77783632 CCACCTACCTTCCCACTGCTCAG 0: 1
1: 1
2: 7
3: 34
4: 506
Right 1055588483 9:77783634-77783656 TATTACTACTTAGGAAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055588477 Original CRISPR CTGAGCAGTGGGAAGGTAGG TGG (reversed) Intronic
900109840 1:1000714-1000736 CAGAGCCGGGGGAAGGTCGGCGG + Intergenic
900386353 1:2412706-2412728 CGGGGCAGCGGGAAGGTAGTCGG + Intronic
900623260 1:3596850-3596872 TAGAGCAGAGGGAAGGTGGGAGG + Intronic
902481028 1:16711965-16711987 CTGTGCAGTGGGAGGGAGGGAGG - Intergenic
903004417 1:20289346-20289368 CTGGGCAGAGGGAATGGAGGAGG - Intergenic
903304237 1:22401465-22401487 CGGAGGAGTGGGAAGGCAGTGGG - Intergenic
904475825 1:30764085-30764107 CTGGGCAGTGGGGAGGCTGGAGG - Intergenic
905172935 1:36119688-36119710 CAGCACAGTGGGAAGGAAGGAGG + Intronic
905489366 1:38331680-38331702 CTGAGGAGGAGGAAGGCAGGTGG - Intergenic
905522937 1:38614173-38614195 CTGAGCAGCTGGAAGGGAGCAGG + Intergenic
906553768 1:46690228-46690250 TTGAGCAGTGGGAAGGGAATGGG - Intronic
906715253 1:47964061-47964083 TTAAGCAGGGGGAATGTAGGGGG - Intronic
906869010 1:49455777-49455799 ATGAGCAAAGGGAAGGTAGCAGG - Intronic
906966418 1:50461447-50461469 CTGAGTTGTGGGTAGGTAGATGG - Intronic
907457725 1:54586103-54586125 CTGTGCAGTGGGTGGGTGGGTGG + Intronic
907519814 1:55015798-55015820 CTGAGCAGAGGGAAGCACGGCGG + Intergenic
908315240 1:62925974-62925996 CTAAGAAGTCTGAAGGTAGGTGG - Intergenic
909134492 1:71780856-71780878 CTCAGAAGAGGGAAGGTGGGTGG - Intronic
909531258 1:76684240-76684262 GGGATCAGTGGCAAGGTAGGGGG + Intergenic
910206267 1:84751729-84751751 CTGAGGGGTGGGAGGGTGGGAGG + Intergenic
910684660 1:89904028-89904050 CTGAGTAGGGGGAAGTTAGGTGG - Intronic
911392018 1:97256947-97256969 GTGTGAAGTGGGAAGGTGGGTGG - Intronic
911830224 1:102541286-102541308 AGGAGCAGGAGGAAGGTAGGAGG + Intergenic
911892585 1:103391268-103391290 CTCAGCGGTTGGAAGGTGGGAGG - Intergenic
911956671 1:104244194-104244216 CTAAGAAGGGGGAGGGTAGGGGG + Intergenic
913256229 1:116956549-116956571 CAGAGCAGCAGGAAGGAAGGCGG + Intronic
913301009 1:117368244-117368266 CTGTGATGTGGGAAGGAAGGCGG - Exonic
914196439 1:145450425-145450447 CTGAGCAGAGGGCAGGATGGTGG + Intergenic
914755773 1:150560966-150560988 CTCAGCAGTGTGAAGGCAGAAGG + Intergenic
915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG + Intergenic
915441852 1:155950520-155950542 CTGAGTAGTGTGAAGATTGGAGG + Intronic
915565380 1:156710022-156710044 CTGAGCCGCGGGAAGGGAGAGGG + Intergenic
916057841 1:161080244-161080266 CTGAGCAGTTGCAAGGTGGGAGG + Intronic
917394582 1:174579262-174579284 CTAATCAGTGGGAAGGGAGTTGG + Intronic
917736647 1:177927216-177927238 CTGTGCACTAGGAAGGGAGGAGG - Intronic
917923808 1:179772214-179772236 GTGAGCAGAGGAAAGGAAGGTGG - Intronic
918332176 1:183471618-183471640 GTGGGAAGTGGGAAGGGAGGAGG + Intergenic
918393618 1:184091962-184091984 CTCAGCAGTTGGATGGTGGGTGG + Intergenic
920351280 1:205339592-205339614 CTGAGCCAAGGGAAGGAAGGAGG + Intronic
921095788 1:211886274-211886296 CTGTGCTGTGGGGAGGAAGGTGG - Intergenic
921165911 1:212506999-212507021 CTGAGAGTGGGGAAGGTAGGAGG - Intergenic
921285830 1:213608289-213608311 CCCAGCAGGGGGAAGGCAGGTGG + Intergenic
921352325 1:214248925-214248947 CTGAACCATGGGAAGGAAGGAGG - Intergenic
921599895 1:217095522-217095544 CTTGGCAGTGGGGAGGGAGGAGG + Intronic
921791401 1:219294696-219294718 CTGAGCTGTGGGAAGGCTTGAGG - Intergenic
922466606 1:225849059-225849081 CTCAGCAGGGTGAGGGTAGGTGG - Intronic
922799703 1:228359666-228359688 CAGAGCAGCGGGAAGGTGAGCGG - Intronic
922998815 1:229988510-229988532 GAGGGCACTGGGAAGGTAGGAGG - Intergenic
1063267133 10:4465364-4465386 CTGATCAGTGCAAGGGTAGGAGG - Intergenic
1063488335 10:6440650-6440672 CTGAGCAGAGGAAAGGAAGCAGG + Intronic
1063488694 10:6443643-6443665 CTGGGCAGAGGGTAGGGAGGAGG + Intronic
1063726961 10:8647800-8647822 CTGGGTAGTGGGAATGTGGGAGG + Intergenic
1065020152 10:21496381-21496403 CGGGGAAGTGGGAAGGGAGGCGG - Intronic
1065478109 10:26163217-26163239 GGGAGCAGTGGGAATGTCGGAGG - Intronic
1065659110 10:27987148-27987170 CTTACCAGTGGTAAGGTAGCAGG + Intronic
1065804925 10:29385395-29385417 CTGAGCCATGGGAAGGGAAGAGG + Intergenic
1066048524 10:31615272-31615294 CTGAGCTCTGGGGAGGTAGTGGG + Intergenic
1066218894 10:33316123-33316145 CTGAGCAGAGGGCAAGAAGGAGG + Intronic
1066395788 10:35020265-35020287 CTGAGAAGTGGGGAGGTGGAAGG + Intronic
1066696094 10:38078801-38078823 CAGAGCAGGAGCAAGGTAGGAGG + Intergenic
1067409636 10:46053148-46053170 CTGAGAGGTGGGAAGGGAGCTGG + Intergenic
1069721033 10:70549509-70549531 CTGAGCCGTGGGGAGACAGGAGG + Intronic
1069801458 10:71084416-71084438 CTGAGCGGTGGGGAGGGAGAGGG + Intergenic
1070493595 10:77000156-77000178 CTGAGCACTTGGAAGGTGAGAGG + Intronic
1072466605 10:95669123-95669145 CAGAGTAGTGGGGGGGTAGGAGG + Intronic
1073186126 10:101615952-101615974 CTGAGCTGTGGGTTGGGAGGTGG - Intronic
1073330702 10:102668408-102668430 CTAAGGAGTGGGAAGGCAGGTGG + Intergenic
1075071172 10:119320823-119320845 CTGAGCACGGGGGAGGTGGGAGG + Intronic
1075158701 10:120003790-120003812 CACTGCAGTGGGAAGGGAGGCGG - Intergenic
1076165655 10:128280514-128280536 CAGAGAAGTGAGAAGGTGGGAGG - Intergenic
1076206688 10:128609758-128609780 CTGGGCAGGGGGAGGGGAGGAGG - Intergenic
1076382410 10:130033946-130033968 CAGAGCCGTGGGAACCTAGGGGG - Intergenic
1076849076 10:133084132-133084154 CAGAGCAGTGGGAAGGGCTGGGG + Intronic
1077107152 11:847228-847250 CTGACCAGTGGGCAGGCAGGTGG - Exonic
1077232469 11:1464090-1464112 CTGAGCAGTGGGGAGCTGGCAGG - Intergenic
1077336302 11:2006349-2006371 CAGAGCAGTGAGATGGAAGGAGG + Intergenic
1077523506 11:3050266-3050288 CCGTGCAGTGGGAAGGAAGCAGG - Intronic
1077774744 11:5258522-5258544 CTGGGCAGTGGGGGGGTTGGTGG + Intronic
1078354458 11:10623770-10623792 CTGAGCAGGAAAAAGGTAGGTGG - Exonic
1078406597 11:11075356-11075378 CTGAGAAGTGGAAAGGCAGCAGG - Intergenic
1079548187 11:21661046-21661068 TTGAACAGTGGGAAGGTAATGGG + Intergenic
1079704552 11:23597962-23597984 CTGAGCTGTGTTAATGTAGGAGG - Intergenic
1080229776 11:30006585-30006607 CTGATTTGTTGGAAGGTAGGGGG + Intergenic
1080822159 11:35817841-35817863 CAGAGCAGAAGGAAGGTGGGGGG - Exonic
1080824281 11:35834865-35834887 GTGAGCAGGGGGAAGGTGGAGGG - Intergenic
1081806011 11:45890929-45890951 CTGAGCAGAGGGCAGGAAGATGG + Intronic
1082853823 11:57788666-57788688 CTTAGGGGTGGGAAGGGAGGGGG + Intronic
1083418763 11:62542019-62542041 CTGGGCAGTGTGCAGGGAGGAGG + Intronic
1083871683 11:65492059-65492081 CTGGGCAGGGGGCGGGTAGGAGG + Intergenic
1084289436 11:68152391-68152413 ATGACCACTGGGAAGGGAGGAGG - Intergenic
1084546433 11:69817353-69817375 CTGCGCACTGGGAAGGCGGGAGG - Intronic
1085152859 11:74266103-74266125 CTGAGAAGTGGGAGTGAAGGTGG + Intronic
1085350264 11:75793641-75793663 CGGCCCAGTGGGAAGGTCGGGGG + Intronic
1085382674 11:76134478-76134500 TGGAGGTGTGGGAAGGTAGGTGG + Intronic
1085507561 11:77068815-77068837 CAGTGCTGGGGGAAGGTAGGTGG + Intronic
1086098205 11:83071588-83071610 GTGAGCGGTGGGGAGGTGGGGGG - Intronic
1086913850 11:92504997-92505019 TTGAGGGGTGGGGAGGTAGGTGG + Intronic
1087144526 11:94798888-94798910 CAGAGCAGTGGGGAGGTTAGTGG + Intronic
1088544024 11:110941928-110941950 CTGAGGAGGAGGAAGGGAGGGGG + Intergenic
1088598735 11:111457727-111457749 GTGAGCTGTGGGAGGGAAGGAGG - Intronic
1088812922 11:113403603-113403625 CTGAGCAGTGTGGATGTAGAAGG - Intergenic
1088859802 11:113789312-113789334 CTGGTCAGTGAGAAGGTCGGAGG + Intergenic
1089216142 11:116835774-116835796 CTGAGCACCGGGAAGGGGGGCGG + Exonic
1090416406 11:126543604-126543626 CTCAGCTGGGGGCAGGTAGGGGG - Intronic
1090578239 11:128132262-128132284 TTGAGCAGTGGGAAGGTAGGAGG - Intergenic
1090806157 11:130203601-130203623 CTGAGCATGGGGAAGGCATGAGG - Intronic
1202819286 11_KI270721v1_random:61531-61553 CAGAGCAGTGAGATGGAAGGAGG + Intergenic
1091799182 12:3313947-3313969 CTGAGTAATGGGAAGGGTGGAGG - Intergenic
1092142476 12:6193450-6193472 CTGAGCAGGGTGAGGGGAGGTGG + Intergenic
1094492988 12:30972798-30972820 CTGCGCAGGGGGGAGGTGGGGGG + Intronic
1095557916 12:43529647-43529669 CTCAGAAGCGGGAGGGTAGGAGG + Intronic
1096557285 12:52411185-52411207 CTGGGCAGGGGGAAGAAAGGAGG + Intergenic
1096876031 12:54631175-54631197 CTCTGCTGCGGGAAGGTAGGGGG + Intronic
1097183434 12:57183910-57183932 GTGAGCAGTGGGCAGGTTTGTGG + Intronic
1097231165 12:57512124-57512146 CTGTGCATGGGGAGGGTAGGCGG + Intronic
1097817041 12:64086235-64086257 CGGAGTAGTGGGAAGGAATGTGG - Intronic
1098391099 12:69970917-69970939 CAGAGCAGGAGGAAGGGAGGGGG - Intergenic
1098925215 12:76342006-76342028 CTGAGCAGGTGGGAGGTGGGTGG + Intergenic
1099315373 12:81077502-81077524 CTGACCACTGAGAGGGTAGGAGG - Exonic
1100847421 12:98674379-98674401 CTGGAAAGTGGGAAGGTAGGAGG - Intronic
1101347080 12:103896004-103896026 CTGAGCACAGAGATGGTAGGTGG - Intergenic
1101740580 12:107496861-107496883 CAGAGCAGTGGTTAGGTAGATGG - Intronic
1102034387 12:109762511-109762533 CTCAGCAGTGGCAAGGATGGTGG - Intronic
1102034944 12:109765737-109765759 CTGATCAGTGGGGAGGTAGCAGG + Intronic
1102044640 12:109822199-109822221 GTGGGCAGTGGGGAGGTGGGTGG + Intronic
1102195512 12:111022500-111022522 CTAAGTAGTGTGAAGGTTGGGGG - Intergenic
1102236849 12:111298981-111299003 CTGAGCCGGAGGAAGGCAGGAGG - Intronic
1102569966 12:113821444-113821466 CTGAGCAGTGGGAAGGCATGGGG + Intronic
1102704694 12:114870828-114870850 CTGAGCAATGGGAAGACAGGAGG - Intergenic
1102821825 12:115915059-115915081 TTGAAGAGTGGGAGGGTAGGGGG + Intergenic
1102931149 12:116863319-116863341 CTGACCAGTGGGAGGGGAGCTGG - Intronic
1103180693 12:118908786-118908808 CATAGCATTGGGAAGGTAGGAGG - Intergenic
1104179852 12:126368743-126368765 CTGAGCAGTGAGAAGGTGTGAGG + Intergenic
1104876025 12:132035443-132035465 CAGAGAAGTGGGAAGTAAGGCGG + Intronic
1105994728 13:25659426-25659448 CTGAGCTGGGGGAACGTTGGAGG + Intronic
1106098094 13:26668276-26668298 CTGAGCTGGGAGAAGGCAGGAGG - Intronic
1106801598 13:33261967-33261989 ACGAGCAGTGAGAAGTTAGGAGG + Intronic
1107113610 13:36723715-36723737 GTTAGAAGTGGAAAGGTAGGGGG - Intergenic
1107356474 13:39572605-39572627 ATGAGCAGAAGGAAGATAGGTGG - Intronic
1108770015 13:53688219-53688241 CAGAGCTGTGGGCAGGAAGGAGG + Intergenic
1109125951 13:58517157-58517179 CTGAGTAGAGGGAATATAGGGGG - Intergenic
1109756646 13:66769901-66769923 CTCAGCAGGGGCAAGGCAGGAGG + Intronic
1110268514 13:73567096-73567118 CAGACCAGTGGGAAGGTGAGAGG + Intergenic
1111443908 13:88320067-88320089 CTGAGCTGAGGGAAGGGAAGAGG + Intergenic
1113337155 13:109387699-109387721 CTGTGGAGTGGGAAGGCAGTGGG - Intergenic
1113402481 13:110006662-110006684 TTGAGCAATGGGAGGGAAGGAGG - Intergenic
1114171452 14:20276705-20276727 TGGAGGGGTGGGAAGGTAGGAGG + Intronic
1115199836 14:30841091-30841113 GTGAGCAACGGGAAGGTTGGTGG - Intergenic
1116638164 14:47424810-47424832 CTAGGCAATGGGAGGGTAGGTGG - Intronic
1117733525 14:58747197-58747219 ATGAGCAGTGGGGAGGTCGTGGG + Intergenic
1118633305 14:67725454-67725476 CTCAGCAATGGGAATGTCGGAGG + Intronic
1118983793 14:70736129-70736151 CTGGACAGTGGGAAGGCAGCTGG - Intronic
1119432038 14:74574855-74574877 GGGAGAAGGGGGAAGGTAGGAGG + Intronic
1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG + Intergenic
1119686113 14:76632672-76632694 CTGAGGAGAGGGAAGGTTGGAGG + Intergenic
1119729665 14:76943009-76943031 CAGAGCAGTTGGAAGGTGGGAGG - Intergenic
1119759002 14:77138591-77138613 CAGAGCAGAGGGAACGTGGGTGG - Intronic
1119947270 14:78708191-78708213 CTGCAGAGTGGGTAGGTAGGTGG - Intronic
1120146963 14:80989247-80989269 ATGAGCAGTGGGCAGGGAAGTGG - Intronic
1120708900 14:87773028-87773050 CTGAGCAGTGGGCGTGCAGGAGG + Intergenic
1121001831 14:90456648-90456670 CTGTGCAGTGGGGAGGTGGGAGG - Intergenic
1121245918 14:92460770-92460792 CTGATAAGTGGGGAGGTGGGAGG + Intronic
1121566406 14:94913253-94913275 CTAAGCAGTGGGAAAGAAGAAGG + Intergenic
1121630050 14:95415286-95415308 CAGAGCAGTGGCAGGGTGGGTGG - Intronic
1122148175 14:99706538-99706560 CTGTGCAGAGTGAAGGTGGGTGG - Intronic
1122578938 14:102759344-102759366 CTGAGCACTGGAGAGGGAGGTGG + Intergenic
1122834515 14:104424273-104424295 CAGGGCAGTGGGATGGAAGGAGG + Intergenic
1122848647 14:104514596-104514618 CTGGGCAGTGAGAAGGCAGGTGG + Intronic
1122937313 14:104966226-104966248 CGGAGCAGTAGGAAGGTGGCGGG - Intronic
1123495184 15:20816913-20816935 CTCTGCAGCGGGAAGGAAGGGGG + Intergenic
1123551676 15:21386006-21386028 CTCTGCAGCGGGAAGGAAGGGGG + Intergenic
1125033252 15:35093763-35093785 CTGAGTGGTGGGAGGGTGGGAGG + Intergenic
1125546199 15:40507358-40507380 GTGAGCAATGGGAAGCCAGGGGG + Intergenic
1127469019 15:59273859-59273881 CCGAGCAGTGAGCAGGGAGGGGG - Intronic
1127530516 15:59839164-59839186 CAGAGCAGTGTGAAGGAAGCTGG - Intergenic
1127637919 15:60888908-60888930 CCGAGGAGTGGGAGGGTGGGTGG + Intronic
1127796520 15:62443023-62443045 CTGAAAAGAGGGGAGGTAGGAGG - Intronic
1128451900 15:67810714-67810736 CTGTGGTGTGGGACGGTAGGAGG + Intergenic
1129449277 15:75641060-75641082 ATGATCAGTGAGAAGCTAGGTGG - Intronic
1129661390 15:77554846-77554868 CGGGGCAGTGGGGAGGGAGGAGG + Intergenic
1130546169 15:84858556-84858578 GTGAGCAGTGGGGAGGGAGAGGG + Intronic
1130893733 15:88154310-88154332 TGAAGCAGTGGGAAGGAAGGAGG + Intronic
1130899093 15:88193429-88193451 GTCAGCAGTGGGGAAGTAGGAGG + Intronic
1131920630 15:97324176-97324198 CAGAGAAGTGGGATGGGAGGTGG + Intergenic
1202960018 15_KI270727v1_random:113248-113270 CTCTGCAGCGGGAAGGAAGGGGG + Intergenic
1132744339 16:1430480-1430502 CTGAGCTCTGGGCAGGTGGGCGG + Intergenic
1132804753 16:1770211-1770233 CTGAGCAGTGGGGCGGCTGGGGG + Exonic
1134096924 16:11424285-11424307 CTGAGCAGTTGGAAGCCACGTGG + Exonic
1134268959 16:12717037-12717059 CTGAACAGGGGGAAAGAAGGTGG + Intronic
1134301502 16:12995620-12995642 CTTAACAGTGGGAAGGTGGAAGG - Intronic
1135494496 16:22939730-22939752 CAGAACAGTGGGAATGTGGGAGG + Intergenic
1135494543 16:22939985-22940007 CAGAACAGTGGGAATGTGGGAGG + Intergenic
1135494589 16:22940240-22940262 CAGAACAGTGGGAATGTGGGAGG + Intergenic
1136095040 16:27949360-27949382 ATGAGCAGTGGTATGGGAGGCGG + Intronic
1137442024 16:48505955-48505977 GAGAGCACAGGGAAGGTAGGAGG + Intergenic
1137538024 16:49342295-49342317 CTGAGCAGAGGGACGCGAGGAGG + Intergenic
1137978984 16:53054418-53054440 CTGAGCAGTGGAAGGGGAAGGGG - Intergenic
1138324594 16:56153753-56153775 CTAAACAGTGGGCAGGTGGGAGG - Intergenic
1139470668 16:67176541-67176563 TTGAGCAGAGGGAAGGCATGGGG - Exonic
1139486622 16:67260572-67260594 CTGAGCGGTGGGAAAGAAGAGGG + Intronic
1141035212 16:80620321-80620343 CTCAGCAGTGGGGAGGTTGATGG - Intronic
1141410346 16:83828803-83828825 CTGAGGAGTGGGGAGGATGGTGG - Intergenic
1142109433 16:88323414-88323436 CAGAGAAGTGGGAAGGAAGAAGG - Intergenic
1142155952 16:88532977-88532999 CTGAGCAGTGGGAAGGGAGTGGG + Intronic
1142212881 16:88816715-88816737 CCGTGCCGTGGGAAGGAAGGTGG - Intronic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1142389851 16:89792162-89792184 CTTTGCAGTGGGAAGTGAGGGGG - Intronic
1142471910 17:169429-169451 CACAGCAGTGTGAAGGTAGAAGG + Intronic
1142567279 17:848884-848906 CTGAGCAGTGGATAGGTACTTGG - Intronic
1142950930 17:3479549-3479571 CAGTGCTGTGGGAAGGTAGAAGG - Intronic
1143479505 17:7220283-7220305 CTGAGCAGTAGGCAGGTACCTGG - Intronic
1143615189 17:8045465-8045487 CTGAGCTGGGGGGAGGCAGGTGG - Exonic
1143620090 17:8075747-8075769 CTGAGGAGTGGGAGGGGAGGAGG - Intronic
1143917798 17:10306772-10306794 CTCAGCAGTGGCAAAGTGGGAGG - Intronic
1146169818 17:30624450-30624472 CTGGTCAGTGAGAAGGTCGGAGG + Intergenic
1146343270 17:32040480-32040502 CTGGTCAGTGAGAAGGTCGGAGG + Intronic
1146716357 17:35089506-35089528 CTGAGCCGTGGGGCCGTAGGAGG + Intronic
1146931506 17:36781269-36781291 CTGGGAAGAGGGAAGGCAGGAGG + Intergenic
1147671470 17:42179286-42179308 CTCACCAGTTGGAAGGCAGGGGG - Intronic
1148080677 17:44966485-44966507 GAGAGCACTGGGAAGGGAGGTGG + Intronic
1148209796 17:45801200-45801222 ATGGGCAGTGGGGAGGAAGGTGG - Intronic
1148465083 17:47860123-47860145 CTGGGGAGTGGGAAGGGATGTGG - Intergenic
1150782681 17:68135537-68135559 CTGGTCAGTGAGAAGGTCGGAGG - Intergenic
1151322440 17:73360001-73360023 CTGAGAGGTGGGGAGGTGGGAGG - Intronic
1151489992 17:74427184-74427206 CTGAGCCCTGGGCAGGGAGGGGG + Intronic
1151714818 17:75825915-75825937 CTGAGCTGTGGTAAGGCAGCTGG + Intergenic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152083951 17:78205894-78205916 CTGAGCAGTGGGAGGGGAGGTGG - Intronic
1152146052 17:78569645-78569667 CCCAGCAGTGGGCAGATAGGAGG - Intronic
1153324914 18:3808720-3808742 AGGAGCAGTAGGTAGGTAGGAGG + Intronic
1154028334 18:10727188-10727210 TTGAGCAGAGGGAAGGCATGGGG + Intronic
1154041048 18:10856440-10856462 GTGAGCAGTGGAATGGAAGGAGG + Intronic
1154452579 18:14489387-14489409 CTCTGCAGCGGGAAGGAAGGTGG + Intergenic
1156261254 18:35446650-35446672 ATGGGCAGTGGCAAGGTAGATGG + Intronic
1156545018 18:37955807-37955829 CTGAGCTGTGAGTAGGTAGAGGG - Intergenic
1158371175 18:56806276-56806298 CTGAGCATGGCGAAGGCAGGAGG - Intronic
1158531757 18:58268967-58268989 CTGAGGCTTGGGAAGGGAGGAGG - Intronic
1158589179 18:58765381-58765403 CTCAGGAGTGGGAGGGTAGGAGG - Intergenic
1160960673 19:1719228-1719250 CTGAGGGGTGGGGAGGGAGGGGG + Intergenic
1161026425 19:2039346-2039368 GTGAGCAGAGGGTAGGTGGGTGG - Exonic
1161455323 19:4366972-4366994 CTGGTCAGTGAGAAGGTCGGAGG - Exonic
1162832855 19:13297954-13297976 CTGAGTAGTGGGAATACAGGTGG + Intronic
1163229297 19:15989303-15989325 CTCAGAAGAGGGAAGGTGGGAGG - Intergenic
1163434927 19:17289758-17289780 CTAAGCAGTGGCGAGGTGGGTGG - Intergenic
1163761082 19:19137224-19137246 CTGAGCTGTGGGGAGGTGGAGGG - Intronic
1163785791 19:19274291-19274313 CTGAGCAGTGGAAAGGAGGTCGG + Intergenic
1164930035 19:32168319-32168341 CTGGGCCGTGGTGAGGTAGGAGG - Intergenic
1165407511 19:35639790-35639812 CTGTGCAGTGGGAAGGGGGACGG + Intergenic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1165923924 19:39315336-39315358 TGGTGCAGTGGGAAGGCAGGAGG + Exonic
1166325278 19:42046126-42046148 CAGGGCAGTGGGAAGGGAGACGG + Intronic
1166392877 19:42419661-42419683 CTGAGCAGGGGTAAGGAGGGCGG + Intronic
1166510997 19:43408422-43408444 CTGAGCCGTGGGCCGGTAGGCGG + Intronic
1166784797 19:45361271-45361293 ATGGGCAGTGGTAAGGGAGGAGG - Intronic
1166868228 19:45854127-45854149 CTGAGCAGGTGAAAGGGAGGAGG - Intronic
1167413144 19:49356692-49356714 AGGAGCAGAGGGAAGGGAGGGGG + Intronic
1167717207 19:51151276-51151298 CTGAGCAGTGGGAAGAATGGAGG + Intronic
1168584676 19:57583257-57583279 CAGGGCAGTAGGGAGGTAGGCGG - Intronic
924971880 2:135898-135920 CAGAGCAGGAGGAAGGGAGGAGG - Intergenic
925522966 2:4768138-4768160 GTTGGCAGTGGGAAGGGAGGAGG - Intergenic
926006529 2:9377350-9377372 CTGAGCAGTAGGGAGGTAGCAGG + Intronic
926104649 2:10142606-10142628 CTGAGCACTGGAATGGGAGGGGG - Intronic
926117024 2:10219875-10219897 CTCAGCCGAGGGGAGGTAGGAGG - Intergenic
926757912 2:16250724-16250746 CTCAGCAGTGGGAATGGCGGGGG + Intergenic
926804882 2:16699047-16699069 CTCAGAAGTGGGAGGGTAGGAGG + Intergenic
927333744 2:21896343-21896365 CTGGGGAGGGGGAAGGTTGGGGG + Intergenic
928326923 2:30326623-30326645 TGGGGCAGTGGGAAGGTGGGTGG - Intergenic
928622768 2:33107914-33107936 CTGAGAGGAGGGAAGGGAGGAGG + Intronic
928915314 2:36464377-36464399 CTGGGAAATGGGAAGGCAGGAGG - Intronic
929484522 2:42342003-42342025 CTAAGCAGGGGGCAGGTGGGAGG + Intronic
929489635 2:42384858-42384880 CAGAGCTGGGGGAAGGCAGGTGG - Intronic
934042300 2:88137725-88137747 GAGAGCAGTGGGAAGGGAAGGGG + Intergenic
935103612 2:100019780-100019802 CTGAGGTGAGGGAAGGTTGGAGG - Intronic
935673381 2:105574121-105574143 CAGAGCAGAGGGAAGGTGGCTGG - Intergenic
935955301 2:108370587-108370609 CTGTGCATTGGGATGGGAGGAGG - Intergenic
936580025 2:113691486-113691508 CTCAGAAGGGGGAGGGTAGGAGG - Intergenic
936581919 2:113708005-113708027 CTGAGCAGAGAGAGGCTAGGAGG - Intronic
936659987 2:114532473-114532495 CTGGGTAGTGGGTAGGTAAGTGG - Intronic
937118685 2:119427323-119427345 TTGAGGAGTTGGAAGGTGGGAGG - Intergenic
937318244 2:120945529-120945551 CTGGGCAGTGGGAAGCTGTGTGG + Intronic
938250601 2:129812933-129812955 CTGAGCAGAGGGGAGGTGAGAGG - Intergenic
938664894 2:133524612-133524634 GAGAGCAGTGGGAAGAAAGGAGG - Intronic
938780777 2:134582829-134582851 CTGAGAGGAGGAAAGGTAGGGGG + Intronic
940071036 2:149688127-149688149 CTGAACAGTGGCAAGGTGGATGG - Intergenic
940265094 2:151828214-151828236 CTGAGCCGGGGGAAGCCAGGCGG - Exonic
941632526 2:167900411-167900433 CTGAGCTGGGGAAAGGAAGGAGG - Intergenic
943351824 2:186805623-186805645 ATGAGCAGGGGGATTGTAGGGGG + Intergenic
943660230 2:190552211-190552233 CTGAGCAGGAGGAAGCAAGGGGG - Intergenic
944229041 2:197375126-197375148 CTGAGCAGAGGGGAGGTAACTGG + Intergenic
946073007 2:217050503-217050525 CTGAGCATTGGGAGGGCAGCAGG - Intergenic
946252198 2:218420533-218420555 CTGAACTGTGGGATGGAAGGAGG - Intronic
946418217 2:219551151-219551173 CTGGGCAGAGGGCAGGAAGGAGG + Intronic
946722399 2:222623904-222623926 CAGAGCGGTGGGGAGGGAGGAGG - Intronic
947293437 2:228603280-228603302 GTGAGCATTGGGAAGTTGGGGGG + Intergenic
947877612 2:233478083-233478105 CTCAGCAGTGGGATGGCGGGTGG - Intronic
1170606745 20:17880339-17880361 CCGAGCAGTGGGCAGTTAGATGG - Intergenic
1170930568 20:20766602-20766624 GTGAGCACTGGGTAGGTGGGTGG + Intergenic
1170940758 20:20846107-20846129 CTGGGCACTGGGCAGGTTGGTGG + Intergenic
1171286378 20:23942382-23942404 CTGAGCAGGTGGAAGTCAGGGGG - Intergenic
1171388012 20:24783159-24783181 CTGGGCAGGGGGAAGGAGGGAGG - Intergenic
1173245561 20:41335248-41335270 GTGAGCAGTGGGCAGGTACGTGG - Intergenic
1173603011 20:44309599-44309621 CTGAGGCCTGGAAAGGTAGGAGG - Intronic
1174260055 20:49287427-49287449 ATTAGGAGTGGGAAGGTATGAGG + Intergenic
1174818529 20:53707847-53707869 CTGACCAGTGGGAAGGAAGGTGG + Intergenic
1176647656 21:9366009-9366031 CTGAGCCCTGGGAGGGGAGGGGG - Intergenic
1177625470 21:23654418-23654440 CTGAGCATTTGGAAAGTAGCTGG - Intergenic
1177925087 21:27204058-27204080 CTGATCACTGGGAAGGCAGAAGG + Intergenic
1178359378 21:31935314-31935336 GTGAGTAGGGGGAAGGTATGCGG - Intronic
1178820780 21:35973164-35973186 CTTAGCCTTGGGAAGGAAGGTGG - Intronic
1179156008 21:38851830-38851852 CTTAGCAGAGGGAAGGAAGCTGG - Intergenic
1179707546 21:43190995-43191017 CTGAGCTGTTGCAGGGTAGGGGG - Intergenic
1179993843 21:44964521-44964543 CTGGGCACTGGGGAGGTATGTGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180190584 21:46160777-46160799 CTGAGCAGTGGCAACGCAGGCGG - Intergenic
1181468334 22:23122721-23122743 ATGGGCAGTGGGAAGATGGGGGG + Intronic
1182297143 22:29316275-29316297 GTGGGCAGGAGGAAGGTAGGAGG - Intronic
1182487551 22:30648390-30648412 TTAAGCTGTGGGAAGGGAGGAGG - Intronic
1182780755 22:32865645-32865667 GAGAGCAGTGGGAAGGGATGTGG - Intronic
1183230286 22:36577913-36577935 CTGGGCAGTGGACAGGTAGCAGG + Intronic
1183353063 22:37344276-37344298 CTGGGCTGTGGGAGGGTTGGTGG - Intergenic
1183507842 22:38219244-38219266 CAGAGCAGGGGGCAGGGAGGAGG + Intergenic
1183618519 22:38959428-38959450 CGGAGCAGGGGGAAGGAGGGTGG + Intronic
1184019105 22:41808676-41808698 CAGAGCCGTGGGATGCTAGGAGG - Intronic
1184191814 22:42900020-42900042 CTGAGATGGGGGCAGGTAGGAGG - Intronic
1184270325 22:43377521-43377543 GTCAGAAGTGTGAAGGTAGGTGG + Intergenic
1184569251 22:45311431-45311453 CTGAGCTGAAGGAAGGTGGGAGG + Intronic
1184664904 22:45983174-45983196 TGGAGCAGGGTGAAGGTAGGGGG - Intergenic
1184869966 22:47231635-47231657 CTGAGCAGTGAGAAGCCATGGGG - Intergenic
1184887305 22:47354247-47354269 ACGAGCAGAGGGAAGGCAGGAGG - Intergenic
1184968092 22:47996000-47996022 CTGGGCAGAGGGAAGGCAGTGGG + Intergenic
1185037365 22:48486486-48486508 CTGAGGAGTGGGGAGGCAGGGGG - Intergenic
1185280680 22:49968623-49968645 CTGAGCAGTGGGACAGCCGGGGG + Intergenic
949934602 3:9106945-9106967 CTGGGGCTTGGGAAGGTAGGTGG + Intronic
949941008 3:9154420-9154442 CTGAGCAGGGGGAGGCGAGGTGG - Intronic
950217603 3:11170442-11170464 CTGGGCAGTGGGAAGATAAATGG + Intronic
950235930 3:11320171-11320193 CGGAGCAAAGGGGAGGTAGGGGG - Intronic
950381845 3:12622667-12622689 TGGAGCAGAAGGAAGGTAGGGGG - Intronic
951420789 3:22482364-22482386 GTGAGCTGAGGGAAGGCAGGAGG - Intergenic
951858870 3:27228325-27228347 CTGAGCAATGGGAGGGAAAGTGG - Intronic
952403990 3:32989332-32989354 GTGAGCAGAGAGAAGGTACGTGG - Intergenic
952643372 3:35625383-35625405 CTCAGAAGTGGGATGGTAGGAGG - Intergenic
952978369 3:38715299-38715321 CTGAGCAGTGGGAATGGAGGTGG - Intronic
953195400 3:40727511-40727533 CTCAGAAGAGGGAAGGTGGGAGG - Intergenic
953884281 3:46706698-46706720 CAGACCGGTGGGAGGGTAGGTGG + Intronic
954628783 3:52037121-52037143 CTGGGCTGGGGGAAGGTGGGAGG + Intergenic
954955431 3:54514555-54514577 CAGGTCAGTGGGAAGGCAGGCGG + Intronic
955352372 3:58203294-58203316 CTCAGAAGTGGGAAGGAAGCTGG - Intronic
955805152 3:62726015-62726037 CTGACCACTGAGAAGGGAGGAGG + Intronic
955931551 3:64062462-64062484 GTAAGCAGTGGGAAGATAAGAGG + Intergenic
956192623 3:66621977-66621999 TTGGGATGTGGGAAGGTAGGGGG + Intergenic
957964723 3:87307453-87307475 CTGAGCAGAGTGAAGAGAGGAGG + Intergenic
959189079 3:103086562-103086584 CTGAGGGATGGGAAGGTTGGAGG - Intergenic
960709778 3:120516400-120516422 CTGAGCAGTGCTAAGTGAGGAGG - Intergenic
960825514 3:121779280-121779302 CTGAGCTGTGGGACTGTAAGTGG - Intronic
961212406 3:125135933-125135955 CCTAGAAGTGGGAAGGTAGATGG - Intronic
961384583 3:126516503-126516525 CTGGGGGGTGGGAGGGTAGGTGG - Intronic
964656151 3:159067909-159067931 CTGAGCAGTGGAATGTGAGGGGG + Intronic
965301826 3:167014483-167014505 ATGAGAAATGGGAAGGTAGTAGG - Intergenic
965689846 3:171344003-171344025 TTGAGCAATGGGAAGGAGGGAGG - Intronic
966474950 3:180333889-180333911 CTGCAGAGTGGGAAGGTAAGGGG + Intergenic
966613762 3:181893042-181893064 CTGAGCTGAGGCAAGGTAGGGGG + Intergenic
966815260 3:183885023-183885045 CTGAGCAGTGGGAGGGGAAGCGG - Intergenic
967741519 3:193008198-193008220 CAGAGAAATGGGATGGTAGGTGG - Intergenic
1202739224 3_GL000221v1_random:38978-39000 CTGAGCCCTGGGAGGGGAGGGGG + Intergenic
968858761 4:3149765-3149787 CAGAGCAGTGGGAAGCTCTGTGG - Intronic
969278783 4:6155036-6155058 CCGAGCAGTGGGAAGACAGTCGG + Intronic
969469521 4:7379275-7379297 CTGAGCCTTGGGAGGGCAGGAGG + Intronic
970710733 4:18859365-18859387 CTGAGCTGTGGGACAGTAAGAGG - Intergenic
970894156 4:21083283-21083305 CTGAGGAGGGGGAAGGAAAGAGG - Intronic
972575023 4:40343624-40343646 CTGAGGAAAGGGAAGGTAAGAGG + Intronic
972793838 4:42397699-42397721 TTGAGGAGTGGGGAGGGAGGTGG + Intergenic
973151806 4:46897664-46897686 TTGAGCAGTGGAGAGGAAGGAGG - Intronic
973299101 4:48559933-48559955 CTGAGCACTTGGAAGGTACCTGG + Intronic
973955460 4:56058952-56058974 CTGTGCATTGTGAAGGTTGGAGG + Intergenic
973969786 4:56201514-56201536 CTGAGCAGTGAGCATGTAAGAGG + Intronic
975290480 4:72672108-72672130 CTCAGAAGTGGGAGGGAAGGAGG - Intergenic
975733177 4:77357188-77357210 CTGAGCCTTGGGCAGATAGGAGG + Intronic
976050045 4:81000941-81000963 CAAAGCAATGGGAAGGTTGGGGG - Intergenic
977786599 4:101042338-101042360 CAGGGCAGAGGGAAGGTGGGAGG - Intronic
978167119 4:105622672-105622694 CTGAGCATTGTGAAGGGAAGAGG - Intronic
980248513 4:130280843-130280865 CAGAAGAGTGGGAGGGTAGGAGG - Intergenic
981326260 4:143451308-143451330 CAGAGTCGTGGGGAGGTAGGTGG + Intronic
984713397 4:182904334-182904356 ATGAACAGTGGGAAGGGAGTTGG - Intronic
984917104 4:184734401-184734423 CTGAGTCGTGGGCAGGTAAGAGG + Intergenic
985512319 5:319584-319606 AAGGGCAGTGGGAAGGAAGGAGG + Intronic
985675576 5:1229814-1229836 CTGAACAGGGGAAAGGTAAGAGG + Intronic
985771822 5:1816660-1816682 CAGAGCAGAGGGAAGGTAAGAGG + Intergenic
986618989 5:9650729-9650751 CAGAGCAGTGGAAAGGGATGAGG - Intronic
986735597 5:10665433-10665455 CTGATCGGTGGGGGGGTAGGAGG - Intergenic
988433242 5:31144386-31144408 TAGAGAAGTGGGAAGGTAAGAGG - Intergenic
990206279 5:53433078-53433100 ATGAGCAGTAGCAAGATAGGAGG + Intergenic
990238171 5:53790252-53790274 ATGAGCAGTGGGAAGTGAGTAGG + Intergenic
990535354 5:56716238-56716260 CTGAGCACTGGGAGGATTGGAGG - Intergenic
991724141 5:69519294-69519316 CTGAGAGGTGGGAGGGCAGGAGG - Intronic
992240157 5:74760665-74760687 CTGAGCAAAGGAAAGGTTGGTGG - Intronic
992792943 5:80230039-80230061 CTGAGCAGTGGGAGGAGAGCTGG - Intronic
993509491 5:88754116-88754138 CTGACCAGTGGGAAGCCAGAGGG - Intronic
993576439 5:89607382-89607404 CTGAGCAGGGTGAGGGTACGGGG + Intergenic
994388678 5:99163531-99163553 CTCAGAAATGGGAAGGTGGGAGG + Intergenic
994546867 5:101177645-101177667 CAGAGCAGGAGGAAGGTGGGTGG - Intergenic
995363101 5:111321411-111321433 CTTAGCAGAGGCAAGGTTGGTGG - Intronic
996620293 5:125493219-125493241 CTGAGCATGGGGAAGGTATTAGG + Intergenic
997211328 5:132078753-132078775 CTGAGCAGTGGGAAAAGAGGGGG - Intergenic
997618895 5:135272221-135272243 CCGAGCTCTGGGAAGGGAGGAGG + Intronic
997645994 5:135482508-135482530 CTCAGCTGTGGGAGGGGAGGGGG + Intergenic
997656331 5:135557571-135557593 CTGAGCACTGGGAATGGAGGGGG - Intergenic
997834312 5:137179904-137179926 GTGTGCAGTGGCAAGGTAGGAGG - Intronic
997923392 5:138004541-138004563 CTGAGCACTTGAAATGTAGGTGG + Intronic
998414165 5:141933461-141933483 ATGAGCAGTGGGCAGGGATGGGG + Intronic
999092634 5:148950760-148950782 CAGAGTAGAGGGAAGGAAGGGGG - Intronic
999233621 5:150077656-150077678 AGGTGCAGTGGGAAGGGAGGGGG + Intronic
999854587 5:155580265-155580287 CTGAGGGCTGGGAAGGTTGGTGG - Intergenic
1000280857 5:159780728-159780750 CTGTGCAGTGTGTGGGTAGGAGG - Intergenic
1001454295 5:171848794-171848816 CTCAGCACTGGGAAGGTATTAGG + Intergenic
1002073545 5:176694895-176694917 CAGAGCAGTGGGCTGGTGGGTGG + Intergenic
1002290059 5:178194292-178194314 CTGTGCAGGGAGAAGGGAGGTGG + Intergenic
1002723801 5:181281881-181281903 CTGAGCCGTAGGAGGGTGGGTGG + Intergenic
1002758695 6:184938-184960 GGGAGCAGTGGGATGGAAGGCGG + Intergenic
1002770134 6:283216-283238 CTAGACAGTGGAAAGGTAGGGGG + Intergenic
1002791577 6:441367-441389 CTGAGCAGGGGTGAGGTGGGAGG - Intergenic
1003881198 6:10481432-10481454 CTGAGCCTTGGGAAAGGAGGAGG - Intergenic
1004121215 6:12824030-12824052 GTGAGCAGTGGGCAAGCAGGCGG + Intronic
1004182078 6:13389927-13389949 CTGAGCAGAGGAAATGCAGGGGG - Intronic
1005980280 6:30831241-30831263 CTGGGGAGTGGGAGGGGAGGAGG - Intergenic
1006170979 6:32092433-32092455 CTGGGAAGAGGGAAGGTAAGAGG + Intronic
1006180654 6:32151719-32151741 CTGAGGAGGGGTAAGGGAGGGGG + Intronic
1006429727 6:33988234-33988256 CTGGACAGTGGGGTGGTAGGTGG + Intergenic
1006457972 6:34142894-34142916 CTGAGCAGGCGGAGGGGAGGCGG - Intronic
1006750270 6:36372660-36372682 CTGAGCAATTGGAAGGGTGGAGG + Intronic
1007254458 6:40518983-40519005 CTGAGCAGTGGGGAGAGAGAGGG + Intronic
1007959622 6:45947012-45947034 CTCAGGACAGGGAAGGTAGGTGG + Intronic
1008005122 6:46402374-46402396 CTGAGCAACTGGAAGGCAGGAGG - Intronic
1008644504 6:53500239-53500261 ATCATCAATGGGAAGGTAGGAGG - Exonic
1010318080 6:74473333-74473355 CTGATCAGTGGACAGGTAGCTGG + Intergenic
1010566296 6:77418256-77418278 CGGAGGAGTGGGAAGGTGAGGGG - Intergenic
1010669470 6:78670766-78670788 AGCAGCAGTGGGAAGGTTGGGGG + Intergenic
1011027527 6:82885696-82885718 CTGAGCACTGAGAAGTCAGGAGG + Intergenic
1011713628 6:90081025-90081047 CTGTGCTGTGACAAGGTAGGAGG + Intronic
1013117175 6:107112470-107112492 CTGGGCATGGAGAAGGTAGGCGG + Intronic
1013524339 6:110960463-110960485 CTGGGGAGTATGAAGGTAGGAGG + Exonic
1015155332 6:130088656-130088678 CTGGGGAGTGGGAAGGAATGAGG - Intronic
1015636269 6:135277808-135277830 CTCAGAAGGGGGAAGGTGGGAGG + Intergenic
1016467775 6:144343848-144343870 CTACGCAGTGGGTAGGGAGGTGG + Intronic
1016533283 6:145082641-145082663 CTGAGAAGTGGGAAAGAAAGAGG - Intergenic
1017757620 6:157542838-157542860 CTGAGCGCTGGGAAGGAAGGAGG + Intronic
1019064835 6:169288174-169288196 CTGAGAAGTGGGAAGGGGTGAGG - Intergenic
1019712424 7:2523748-2523770 CTGAGCAGTGGGAGGGGTGCTGG + Intronic
1021712673 7:23431617-23431639 CTGAACAGGAGGAAGGAAGGGGG + Intronic
1022158000 7:27679814-27679836 CTGAGCACTTGAAAGGTAGCTGG - Intergenic
1022468927 7:30669910-30669932 GTGAGCAGTGGGTAAGAAGGAGG - Intronic
1022881084 7:34588074-34588096 CTTGGCAGTGGAAGGGTAGGGGG - Intergenic
1022892918 7:34719312-34719334 CTCAACAGAGGGAAGGAAGGAGG + Intronic
1023348906 7:39300007-39300029 CTCTGCAGTGGGAAGTAAGGCGG - Intronic
1023365357 7:39458189-39458211 CTGAGCAGGGAGCAGGTTGGAGG + Intronic
1023713022 7:43014634-43014656 CTGTGCAATGGAAGGGTAGGTGG + Intergenic
1023871235 7:44264076-44264098 CTCAGCACTGGGCAGGTAGAGGG - Intronic
1023909668 7:44544448-44544470 AAGAGTAGTGGGGAGGTAGGGGG + Intergenic
1024246356 7:47473048-47473070 CTGAGCAGTCGGGTGGGAGGAGG - Intronic
1024877034 7:54037570-54037592 TAGAGCTGTGGGAAGGAAGGAGG - Intergenic
1024996288 7:55275326-55275348 CTGTGCAGTGGGAAGGGAAAGGG - Intergenic
1026204719 7:68246851-68246873 CTGAGCACTGGGATGATAGGGGG + Intergenic
1026277624 7:68894059-68894081 ATGAGCAGTCGAAAGGTATGAGG - Intergenic
1026461892 7:70621582-70621604 TTGAGGGGTGGGAGGGTAGGAGG + Intronic
1029942174 7:104491667-104491689 CTAAGCAATGTGCAGGTAGGAGG + Intronic
1031321825 7:120339756-120339778 CAGAGCAGAGGGAAGGGAAGGGG + Intronic
1031598196 7:123671742-123671764 CTGTCCAGTGGGAAGACAGGAGG - Intergenic
1031831907 7:126638315-126638337 CAGAGCAGTAGGAAGGTATCTGG - Intronic
1031871248 7:127091703-127091725 ATGATCAGTGGGATGGCAGGGGG - Intronic
1032448485 7:132004831-132004853 CTTAGGGGAGGGAAGGTAGGTGG + Intergenic
1032959116 7:137009897-137009919 CTTAAGAGTGGGAAGGTATGGGG - Intronic
1034071684 7:148192046-148192068 CTGAGGAGTGGGAAGTGGGGAGG + Intronic
1034427241 7:151020466-151020488 CTGAGCAGAGGAGAGGGAGGAGG - Intronic
1034728993 7:153366981-153367003 CTGAGCAGGAGGAAGAGAGGAGG + Intergenic
1034923539 7:155102857-155102879 CTGAGCAGTGGGAAGAGATGTGG - Intergenic
1035486755 7:159232068-159232090 CTGTGCTGTGTGAAGGCAGGTGG + Intergenic
1037281629 8:17247559-17247581 CTGAGCAGTGGTGCGGCAGGAGG - Intronic
1037598374 8:20373506-20373528 GAGAGCAGTGGGGATGTAGGAGG + Intergenic
1038691975 8:29772506-29772528 CTCAGCAGAGGGAAGGGAGGAGG + Intergenic
1038819833 8:30942153-30942175 CTGAGCAGTGGCGAGCCAGGGGG + Intergenic
1039409493 8:37340758-37340780 CTGAGCAGAGGGAAGGTTCTCGG + Intergenic
1039883979 8:41645303-41645325 CTGAGCTGCTGGCAGGTAGGGGG - Exonic
1040807218 8:51408261-51408283 CTCAGGACTGAGAAGGTAGGAGG + Exonic
1040893053 8:52337600-52337622 ATGAGCAGTGTGAAGGTGTGGGG + Intronic
1042026926 8:64433644-64433666 CTGATCAGTGGCAGGGGAGGAGG + Intergenic
1042386691 8:68184107-68184129 ATGGGCATGGGGAAGGTAGGTGG + Intronic
1042593389 8:70420550-70420572 CTTTGCTGTGGGAAGGGAGGTGG + Intergenic
1043109952 8:76168649-76168671 ATTACCAGGGGGAAGGTAGGGGG - Intergenic
1044560457 8:93606850-93606872 CTGAACAGGGGGATGGGAGGTGG + Intergenic
1044832332 8:96262158-96262180 CTGAGCAGGGTGATGGTATGCGG - Exonic
1045249702 8:100473254-100473276 CAGAGCAGTGGGAAGGGAGGAGG + Intergenic
1046206376 8:111003487-111003509 GTTGGCAGTGGGCAGGTAGGAGG + Intergenic
1049365240 8:142233897-142233919 CTGTGCAGGGGGAAGCTGGGAGG - Intronic
1050119435 9:2293332-2293354 CTTAGGAGTTGGGAGGTAGGTGG - Intergenic
1053411297 9:37917672-37917694 TGGGGGAGTGGGAAGGTAGGTGG - Intronic
1055154139 9:73039850-73039872 CTGAGTAGTGAGTAGGTGGGAGG - Intronic
1055340088 9:75272396-75272418 CTCAGAAGGGGGAAGGTGGGAGG - Intergenic
1055588477 9:77783610-77783632 CTGAGCAGTGGGAAGGTAGGTGG - Intronic
1055760458 9:79601679-79601701 CTGAGGAGAGGGAAAGAAGGGGG - Intronic
1055766614 9:79670499-79670521 TTGAGCAGTGGGAAAGGAGGGGG - Intronic
1055913226 9:81374601-81374623 CTGCTGAGTGGGAAGGTGGGAGG - Intergenic
1056526429 9:87447018-87447040 CTGTCCAATGGGCAGGTAGGAGG - Intergenic
1056690496 9:88804197-88804219 GTGAGCGGTGGGAAGTTGGGAGG + Intergenic
1056934152 9:90903141-90903163 CTGCGCAGATGGAAGGTCGGGGG - Intergenic
1057134915 9:92680696-92680718 CTAGGCAGAGGGAAGGAAGGGGG + Intergenic
1057210660 9:93199338-93199360 CTGGGCAGGGCTAAGGTAGGAGG - Intronic
1057491216 9:95521353-95521375 CTGAGGAGTAGGAAGGCAGTTGG + Intergenic
1057506450 9:95637485-95637507 CTGAGCACTGGGAATGTGGCTGG + Intergenic
1057519705 9:95751534-95751556 CTGAGCTGTGGGAGGGAGGGAGG + Intergenic
1057828812 9:98391811-98391833 CTGAGCAGTGGGGACGTGCGGGG + Intronic
1058261803 9:102842629-102842651 CTGAGTGTTGGAAAGGTAGGTGG + Intergenic
1058830258 9:108810174-108810196 CTGGGGAGTGTAAAGGTAGGAGG + Intergenic
1058940953 9:109812224-109812246 CTGAGAAGGGAGAAGGGAGGAGG + Intronic
1058971365 9:110086158-110086180 CTGAGAAGTGGGAGGGTGTGGGG + Intronic
1059835757 9:118150240-118150262 CTGAGCAATGGGAGGGAAAGTGG + Intergenic
1060117293 9:120952184-120952206 CAGCGCACTGAGAAGGTAGGTGG - Intergenic
1060215147 9:121734442-121734464 CTGAGCAGGGGCTAGGAAGGAGG + Intronic
1060531976 9:124353048-124353070 CAGAGCTGTGTGAAGGTGGGTGG - Exonic
1060557493 9:124516174-124516196 CTGAGGAATGGGAAGGCAGCTGG + Intergenic
1060892597 9:127198278-127198300 CTGAGCACTGGGAAAGGGGGAGG - Intronic
1062028959 9:134353351-134353373 CTGGAGAGTGGGAAGGCAGGTGG + Intronic
1062046451 9:134426695-134426717 CGGGGCAGTGGGAGGGGAGGTGG + Intronic
1062140533 9:134955424-134955446 CAGAGCAGAGGGAAGGCAGCTGG + Intergenic
1062432655 9:136532937-136532959 GTGGGCAGTGGGAATGGAGGTGG - Intronic
1062698293 9:137886410-137886432 CTGAGCAGAGGGCAGGATGGTGG - Intronic
1203707955 Un_KI270742v1:69422-69444 CTGAGCCCTGGGAGGGGAGGGGG + Intergenic
1185926437 X:4152314-4152336 CTCAGAAGGGGGAGGGTAGGGGG - Intergenic
1186816209 X:13240470-13240492 CTGGGAACTGGGCAGGTAGGAGG - Intergenic
1187128348 X:16475686-16475708 CTGTGGAGGGGGAAGTTAGGAGG + Intergenic
1188388488 X:29591098-29591120 CAGAGCAGTGGGAGGGGAGATGG + Intronic
1188532858 X:31161877-31161899 GAGGGCAGTGGGATGGTAGGTGG - Intronic
1189560336 X:42185633-42185655 AAGAGCAGTGCAAAGGTAGGGGG + Intergenic
1190343180 X:49313506-49313528 TTTAGGAGTGGGAATGTAGGAGG + Intronic
1190790540 X:53696053-53696075 CTTAGCAGTGAGAAGGCCGGAGG + Intergenic
1191716420 X:64196860-64196882 CAGAACACTGGGAAGGAAGGTGG + Intronic
1192037074 X:67575149-67575171 CTGAGCAGTGGGAGTGGAGCAGG + Intronic
1192291180 X:69796373-69796395 CTGAGTAGTGGGATTCTAGGTGG - Intronic
1193276757 X:79597866-79597888 CTGAGCTGGGGGAAATTAGGTGG - Intergenic
1194088517 X:89558251-89558273 CTCAGAAGGGGGAGGGTAGGAGG + Intergenic
1195767150 X:108307826-108307848 CTTGGCCCTGGGAAGGTAGGAGG + Intronic
1197407585 X:126071145-126071167 CTGAGGAGTGGGAAGAAGGGAGG + Intergenic
1197586633 X:128355943-128355965 CTGAGTCTAGGGAAGGTAGGAGG - Intergenic
1197728194 X:129790357-129790379 CTGAGGTGTGGTGAGGTAGGGGG + Intronic
1197772495 X:130098108-130098130 CTGAGCCATGGGCAGGCAGGGGG + Intronic
1198739528 X:139826238-139826260 TTGAGAAGTGGGATGGGAGGTGG + Intronic
1199397609 X:147357832-147357854 CAGAGAAGTAGGAGGGTAGGAGG + Intergenic
1199467780 X:148158883-148158905 AGCAGCAGTGGGAAGGTAGAAGG - Intergenic
1200154953 X:153970416-153970438 CCGATCAGTGGGGAGGGAGGGGG + Intronic
1200441193 Y:3214298-3214320 CTCAGAAGGGGGAGGGTAGGAGG + Intergenic