ID: 1055591924

View in Genome Browser
Species Human (GRCh38)
Location 9:77825550-77825572
Sequence CCTGCTAATATGGAGTAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055591924_1055591929 28 Left 1055591924 9:77825550-77825572 CCAGCTTACTCCATATTAGCAGG 0: 1
1: 0
2: 1
3: 8
4: 72
Right 1055591929 9:77825601-77825623 GATGCAGTTAACAATGCATCTGG No data
1055591924_1055591930 29 Left 1055591924 9:77825550-77825572 CCAGCTTACTCCATATTAGCAGG 0: 1
1: 0
2: 1
3: 8
4: 72
Right 1055591930 9:77825602-77825624 ATGCAGTTAACAATGCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055591924 Original CRISPR CCTGCTAATATGGAGTAAGC TGG (reversed) Intronic
900878529 1:5363874-5363896 CCTGCTTATTTGGGGGAAGCTGG + Intergenic
905104044 1:35552149-35552171 CCTGCCAACATGGAGAAACCTGG + Intronic
908054808 1:60273446-60273468 TCTGCTTGTATGGAGAAAGCAGG - Intergenic
915746879 1:158168027-158168049 ACAGCTAATCAGGAGTAAGCAGG + Intergenic
920098514 1:203501898-203501920 CCTCCTAATATGGAGACAGCTGG - Intronic
1064500606 10:15968769-15968791 TGAGCTAATAGGGAGTAAGCTGG + Intergenic
1070686968 10:78491939-78491961 CCTGCTATCATGGTGTCAGCAGG + Intergenic
1071628124 10:87194067-87194089 CCTGTTAAAATGGAGTTACCAGG + Intergenic
1075190771 10:120306357-120306379 CCGGCCAATATGGAATAAGAGGG - Intergenic
1079699937 11:23532927-23532949 CATGCTAATAGGGAGTAATAGGG - Intergenic
1082062467 11:47872515-47872537 CCTGCTACTCAGGAATAAGCAGG + Intergenic
1083422134 11:62559819-62559841 CCTGCCAATCTGGACTCAGCTGG + Exonic
1086269635 11:85046068-85046090 GCTAATAATATGGAGGAAGCAGG - Intronic
1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG + Intronic
1091776347 12:3187423-3187445 CCTGCTTTTATGGACGAAGCTGG - Intronic
1095692400 12:45104882-45104904 CCAGCTAAGATGGAGTAATAGGG + Intergenic
1097354182 12:58583217-58583239 TCTGCTAATATAGACTCAGCAGG + Intronic
1099239264 12:80118980-80119002 CCTGCTCATAGAGAGGAAGCTGG + Intergenic
1099859294 12:88208012-88208034 CCGGCTAATCTGGGCTAAGCAGG - Intergenic
1101004509 12:100388764-100388786 AATGCAAATATGGAGTAAGAGGG - Intronic
1106694938 13:32163046-32163068 CATGCTAATATTGAGTCACCCGG + Intronic
1107373967 13:39782234-39782256 CCAGCCAATATGGAGTAACAGGG + Intronic
1107625122 13:42273999-42274021 TTTGCTAAGATGGAGTAAGAAGG - Intronic
1107824685 13:44317931-44317953 CATGCTAATATAAAGTAATCAGG + Intergenic
1111255748 13:85666026-85666048 CCTGCTAATTTGAAGTCAGATGG - Intergenic
1112933780 13:104774336-104774358 CCTGCCAAGATGGAATAAACAGG + Intergenic
1115876750 14:37869759-37869781 TGTGCTCCTATGGAGTAAGCAGG + Intronic
1117152760 14:52906077-52906099 CCTGCCCATAGGCAGTAAGCTGG - Intronic
1120029916 14:79629645-79629667 ACTGCTAATAGGGAGTAAGCAGG + Intronic
1128392981 15:67195619-67195641 CCTGACAATATGGAGGAATCAGG - Intergenic
1131363651 15:91818348-91818370 CCTGCTAAAAAGGATAAAGCTGG + Intergenic
1132416081 15:101619792-101619814 CATGAAAATATGGAGTAAGCAGG - Intergenic
1137315609 16:47318075-47318097 GCTGCTAATAATGAGTAATCAGG + Intronic
1151114635 17:71721704-71721726 CCTGCGTATACAGAGTAAGCTGG + Intergenic
1164191190 19:22918688-22918710 CCTCTGAATAGGGAGTAAGCAGG - Intergenic
1165631795 19:37307386-37307408 CCCGCTACTATGCAGTAAGCAGG + Intergenic
926515628 2:13841496-13841518 CCCACTAAGAAGGAGTAAGCAGG + Intergenic
927211463 2:20641506-20641528 CCTCCTGATATGCAGAAAGCTGG - Intronic
927252582 2:21010936-21010958 TCTGCTCAGCTGGAGTAAGCAGG + Exonic
937892010 2:126946280-126946302 CCTGCTAATCTGCATTAATCTGG - Intergenic
938109362 2:128553630-128553652 GCTACCAATAAGGAGTAAGCTGG - Intergenic
941606423 2:167602980-167603002 CCTGCCATTATTGAGTAAGGTGG - Intergenic
943881720 2:193154025-193154047 CCTGCAAGTATGGAGTAATCAGG + Intergenic
944962778 2:204894491-204894513 CCTGTTAATAATGAGGAAGCTGG - Intronic
945053347 2:205846794-205846816 CCTGCTAATAAGAACTATGCAGG - Intergenic
1171455441 20:25269431-25269453 CTTGCCAGCATGGAGTAAGCTGG + Intronic
1172461062 20:35119017-35119039 CCTGCTACTAAGGAGGAAGCGGG - Intronic
1179612581 21:42562029-42562051 CCTCCAAATGTGGAGTCAGCAGG - Intronic
949624825 3:5853689-5853711 CCTGCAAGTATGGAGCAAGCTGG + Intergenic
951237501 3:20252714-20252736 CCTGCCATTATGATGTAAGCTGG + Intergenic
955625439 3:60913641-60913663 CCTGCCAATATTGAAGAAGCAGG - Intronic
966451544 3:180068608-180068630 CCAGCCAAGATGGAGTAAGAGGG - Intergenic
971225737 4:24750039-24750061 CATGCTATTATGTATTAAGCAGG + Intergenic
971476128 4:27074272-27074294 CCTGTTATTATGGTGTTAGCTGG + Intergenic
974277480 4:59743197-59743219 CCTGGTAATGTGGGGTAAGGAGG - Intergenic
977178428 4:93842755-93842777 CCTTCTAACAGGAAGTAAGCAGG - Intergenic
980650831 4:135712592-135712614 CCCTTTATTATGGAGTAAGCAGG - Intergenic
988272137 5:29031167-29031189 TCTGCTACTAAGGGGTAAGCAGG + Intergenic
988337597 5:29926826-29926848 CCAGCTAATTTGGAATAAGTGGG - Intergenic
994881712 5:105506449-105506471 CCAGCTAATATGGAGAGAGGTGG - Intergenic
997886837 5:137637747-137637769 ACTGCTAAGATAGAGGAAGCTGG - Intronic
999065625 5:148682877-148682899 CATGTTAGTATGGAGAAAGCAGG - Intergenic
1004013490 6:11711232-11711254 CCTGTTTCTATGGATTAAGCTGG - Intergenic
1004646434 6:17566054-17566076 CCTGCCAACATGGTGAAAGCCGG + Intergenic
1005852128 6:29829680-29829702 CATGCTGAGATGGAGTAAGGAGG + Exonic
1010667653 6:78648834-78648856 CCTGCCATTATGGTGTTAGCTGG - Intergenic
1011717254 6:90120315-90120337 CCTGCTGAAATAGAGAAAGCAGG - Intronic
1011829138 6:91349495-91349517 CCTACTGATATGGAGAAAGTTGG + Intergenic
1017146446 6:151239933-151239955 CCTGCTAATGGGGAGGAGGCTGG + Intergenic
1022550057 7:31229499-31229521 CCTGCTCAGATGGGGTAAGCTGG - Intergenic
1024819191 7:53307146-53307168 CCTGGTCTTATGGAGTAAGCAGG + Intergenic
1032483811 7:132267861-132267883 CCTGCTGCTAAGAAGTAAGCAGG - Intronic
1037032181 8:14122083-14122105 CCTGCTAACATGGTGAAACCCGG + Intronic
1038016145 8:23516831-23516853 GCTGTTATTAAGGAGTAAGCTGG - Intergenic
1046802272 8:118441720-118441742 CCTGCTGAAATGGAGTAGGAGGG - Intronic
1051779579 9:20674654-20674676 CCTGCTAAGTTGGAGAAAGTAGG + Intronic
1055591924 9:77825550-77825572 CCTGCTAATATGGAGTAAGCTGG - Intronic
1189341183 X:40205815-40205837 CCTGCTAAAAAGGAGCAAGAGGG + Intergenic
1193886809 X:86993105-86993127 CCTGCTAAGATGAAGTAACAGGG - Intergenic
1194147033 X:90278022-90278044 CCTGGTAGTAAGGAGTAAGGAGG + Intergenic
1196039598 X:111187985-111188007 ATTGCATATATGGAGTAAGCGGG + Intronic
1200493434 Y:3854789-3854811 CCTGGTAGTAAGGAGTAAGGAGG + Intergenic